DNA molecules encoding arginine deiminase and uses thereof
An arginine deiminase and DNA molecule technology, applied in the field of L-citrulline production, can solve the problems of excess substrate, unfavorable long-term preservation and use of the enzyme, low catalytic ability and temperature stability, etc. The cost of production and use, the effect of high salt concentration resistance, good thermal stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1. Codon Optimization of Nucleotide Sequence Encoding Arginine Deiminase The protein sequence of arginine deiminase was obtained from NCBI database. According to the protein sequence information (SEQ ID NO:2) of arginine deiminase (ADI) of Pseudomonas aeruginosa strain3 Re2-7 and the codon preference rule of Escherichia coli, the gene sequence is coded Sub-optimization (SEQ ID N NO: 1), after designing and adding EcoRI and HindIII restriction sites at both ends of the gene, it was sent to Sangon Bioengineering (Shanghai) Co., Ltd. for artificial synthesis.
[0053] SEQ ID NO:1
[0054] ATGATGTCAACCGAAAAAACGAAACTGGGTGTTCATAGCGAAGCTGGCAAACTGCGTAAGGTGATGGTCTGTTCTCCGGGTCTGGCTCATCAGCGTCTGACCCCGAGCAACTGCGACGAACTGCTGTTTGATGACGTTATTTGGGTCAATCAAGCCAAACGCGACCATTTTGATTTCGTGACCAAGATGCGTGAACGCGGCATTGATGTTCTGGAAATGCACAACCTGCTGACCGAAACGATCCAGAATCCGGAAGCTCTGAAATGGATTCTGGACCGTAAGATCACGGCAGATTCGGTTGGCCTGGGTCTGACCTCAGAACTGCGTTCGTGGCTGGAAAGCCTGGAACCGCGTAAACTGGCGGAATATCTGATTGGCGGTGT...
Embodiment 2
[0058] Example 2. Construction of strains expressing arginine deiminase
[0059] After designing and adding EcoRI and HindIII restriction sites at both ends of SEQ ID NO:1, it was sent to Shanghai Sangon Co., Ltd. for artificial synthesis and constructed on the pET21a plasmid. The plasmid was transformed into Escherichia coli BL21(DE3) (purchased from Sangon Bioengineering (Shanghai) Co., Ltd.) by the heat shock method. After culturing overnight at 37°C, positive transformants were selected and sequenced again. The sequenced correct transformants were genetically engineered. bacteria.
Embodiment 3
[0060] Example 3. Bacterial strain culture expressing arginine deiminase
[0061] 3.1 Colony morphology: pale yellow, rounded edges, smooth surface, and small bumps.
[0062] 3.2 Medium:
[0063] Seed medium: peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, adjust the pH to 7.0-7.2 with 30% (w / v) sodium hydroxide aqueous solution, sterilize at 121°C, sterilize Bacteria time was 20 minutes; sterile filtered ampicillin sodium aqueous solution (final concentration 75 mg / L) was added before inoculation.
[0064] Seed bottle liquid volume 20-40ml / 250ml seed bottle, triangular flask or fermentation bottle liquid volume 50-100ml / 500ml triangular flask or fermentation bottle.
[0065]Fermentation medium: yeast extract 15g / L, sodium chloride 3g / L, ammonium chloride 2g / L, dipotassium hydrogen phosphate 0.75g / L, potassium dihydrogen phosphate 0.75g / L, magnesium sulfate heptahydrate 0.75g / L, pH7.0-7.2, sterilization temperature 121°C, sterilization time 20 minutes; liquid vol...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


