Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Pseudo-ginseng inducible promoter R1 and application thereof

A promoter and inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve the problems of short plants, excessive accumulation of gene products, growth deformity and so on

Active Publication Date: 2021-11-16
KUNMING UNIV OF SCI & TECH
View PDF12 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the gene expression induced by constitutive promoters continues throughout the life cycle of the plant, it often leads to excessive accumulation of gene products, causing metabolic disorders in plants, and even causing stunted plants and growth deformities.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudo-ginseng inducible promoter R1 and application thereof
  • Pseudo-ginseng inducible promoter R1 and application thereof
  • Pseudo-ginseng inducible promoter R1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Cloning and sequence analysis of Panax notoginseng-inducible promoter R1

[0023] Using the extracted Panax notoginseng genomic DNA as a template, use the specific primers for amplifying the promoter R1 (the upstream primer is 5'TTTTTAGGCTTTAGGCCAAC3', the downstream primer is 5'AATTTGCTCTAGAGCGAGCT3', and clone the sequence of the promoter R1 by PCR; the reaction system (20μL ) is Panax notoginseng genomic DNA 0.5μg, 2μL 10×Advantage 2 PCR Buffer, 1.8μL dNTP Mix (10mM each), 0.2μL upstream primer (10μM), 0.2μL primer (10μM), 0.2μL Advantage 2PCR Polymerase Mix, 14.6μL PCR-Grade water.PCR reaction conditions: 94°C for 5 min; 94°C for 30s, 58°C for 30s, 72°C for 45s, 32 cycles; 72°C for 5min. After PCR, take 8μL for agarose gel electrophoresis for detection Specificity and size of amplified products.

[0024] The PCR product obtained has only one DNA band, and the PCR product is directly cloned by TA. The kit used is pGEM-T vector system (Promega). vector (5...

Embodiment 2

[0025] Example 2: R1 -GUS Expression vector construction

[0026] The pBI121 multiple cloning site has Hin dⅢ and Bam HI restriction sites, so specific primers for amplifying promoters were added Hin dⅢ and Bam HI recognition site. Plasmids pGEM-T-R1 and pBI121 were extracted from Escherichia coli using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 1 μL was used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmids high and low. restriction endonuclease Hin dⅢ and Bam HI performed double enzyme digestion on plasmids pGEM-T-R1 and pBI121 respectively (50 μL system). The reaction system and operation process are as follows: take 25 μL of pGEM-T-R1 and pBI121 plasmids in two 200 μL centrifuge tubes, and then add 5 μL of 10×H buffer and 2.5 μL of Bam HI, 2.5 μL Hin dIII, 15 μL ddH 2 O. After mixing, centrifuge for a short time, and place it at 37°C for overnight reaction; perform agarose...

Embodiment 3

[0029] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants

[0030] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16 h / d light) after germination, and then Subculture once a month with MS medium.

[0031] Store the pBI121-R1 containing pBI121-R1 in the -80℃ refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and cultured with shaking at 28°C and 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pseudo-ginseng inducible promoter R1 and application thereof, the nucleotide sequence of R1 is shown as SEQ ID NO: 1, and molecular biology and genetic engineering related technical researches prove that the pseudo-ginseng promoter R1 responds to several plant hormones, biological stress and abiotic stress; a fusion expression cassette constructed by the panax notoginseng promoter R1 and the beta-glucuronidase gene is transferred into tobacco for expression, and the activity of the glucuronidase of the transgenic tobacco is quantitatively detected through a fluorescence method. The result shows that after the transgenic tobacco is treated by fusarium oxysporum, fusarium solani, alternaria alternata, NaCl, AlCl3, gibberellin, methyl jasmonate, salicylic acid, abscisic acid and ethephon, the activity of glucuronidase is obviously enhanced; the pseudo-ginseng promoter R1 is induced by several plant hormones and biological and abiotic stress factors, and can be used for plant disease-resistant gene engineering.

Description

technical field [0001] The invention relates to the research fields of molecular biology and genetic engineering, in particular to a notoginseng inducible promoter R1 and its application. Background technique [0002] A promoter is a DNA sequence located in the upstream region of a gene that regulates the initiation of transcription, and is one of the important cis-regulatory elements. The promoter sequence mainly includes core promoter elements and upstream promoter elements. Among them, the core promoter elements include transcription initiation site, TATA box and 5' untranslated sequence, which mainly control the transcription initiation of genes. Upstream promoter elements include CAAT box, GC box, and some constitutive and specific elements, which can be combined with corresponding trans-acting factors to improve transcription efficiency. In plants, promoters can be divided into constitutive promoters, inducible promoters and tissue-specific promoters according to the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/84A01H5/00A01H6/82
CPCC07K14/415C12N15/8205C12N15/8238C12N15/8239
Inventor 刘迪秋邓婕梁婷婷苏琳琳曲媛崔秀明
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com