Heat-resisting glucamylase as well as coding gene and application thereof

A technology of glucoamylase and coding gene, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of Mucor micromycetes that have not been reported, and achieve the effect of good thermal stability

Active Publication Date: 2013-05-29
EAST CHINA UNIV OF SCI & TECH
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the glucoamylase gene and protein amino acid sequence of Rhizomucor pusillus have not been reported so far.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heat-resisting glucamylase as well as coding gene and application thereof
  • Heat-resisting glucamylase as well as coding gene and application thereof
  • Heat-resisting glucamylase as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1. Amplification of Glucoamylase Gene

[0024] 1.1 Strain and its culture

[0025] Rhizomucor pusillus (strain number 3.204) was purchased from CGMCC, General Microbiology Center of China Microorganism Culture Collection and Management Committee in Beijing.

[0026] Mucor spores were washed from PDA slants cultured for 5-6 days with sterile water, inoculated with liquid medium, and cultured at 30°C for 2-3 days to collect mycelia for genome or RNA extraction.

[0027] 1.2 Genome extraction

[0028] Refer to Omega Fungal Genome Extraction Kit Instructions

[0029] 1.3 Total RNA extraction

[0030] The spores on the slanted surface of the PDA cultured for 6 days were washed with sterile water, inoculated with a fungal amylase-producing liquid medium, cultured for 2-3 days, and the mycelia were collected by gauze filtration. Follow the instructions of Takara RNA extraction reagent.

[0031] 1.4 cDNA first-strand synthesis

[0032] Using the extracted total mR...

Embodiment 2

[0093] Example 2. Construction and transformation of Pichia pastoris recombinant expression vector containing glucoamylase gene

[0094] 2.1 Primer design

[0095] The sequence of R.pGEcoRf is SEQ ID NO. 23: GGAATTCATGCGTTATGCAACCCCGC

[0096] The sequence of R.pGNotr is SEQ ID NO. 24: TTGCGGCCGCTTACCCTCTTTTGACCA

[0097] 2.2 Construction of recombinant expression vector

[0098] Using the pMD19-T Vector with the open reading frame of the glucoamylase gene as a template, PCR amplification was carried out with the primers shown in 3.1; the PCR products were digested with EcoRI and NotI, and then expressed with the yeast that was also digested with EcoRI and NotI. The vector pPIC9k was ligated and screened to obtain a recombinant plasmid (pPIC9KR.pGLA).

[0099] 2.3 Preparation of Pichia pastoris competent cells

[0100] (1) Inoculate yeast in YPD liquid medium and cultivate at 30°C to OD1-2A (600nm)

[0101] (2) Centrifuge the culture solution at 6000rpm at 4°C for 3min, a...

Embodiment 3

[0111] Example 3. Inducible expression of Pichia pastoris

[0112] 3.1 Pick a single clone of the recombinant bacteria on the G418-containing YPD plate described in 3.5, inoculate the YPD liquid medium, and cultivate at 30°C and 200rpm for 24h.

[0113] 3.2 The above-mentioned seed culture medium was inserted into BMGY medium, and cultured at 30°C and 200rpm for 24h.

[0114] 3.3 Culture to OD6.0, 6500rpm, centrifuge for 5min to collect bacterial cells, transfer to BMMY medium, 225rpm, and induce expression at 30°C, add 100% methanol every 24h to a final concentration of 0.5%.

[0115] 3.4 After induction for 120 h, the supernatant was collected by centrifugation, the enzyme activity was measured, the protein concentration was measured, and protein electrophoresis was performed.

[0116] figure 1 The electropherogram showing the induced expression of Mucor glucoamylase Pichia pastoris KM71 recombinant bacteria.

[0117] The recombinant Pichia pastoris constructed by the pre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a heat-resisting glucamylase which is protein meeting the following condition (a) or (b): (a) the protein contains an amino acid sequence shown as SEQ ID NO.22; and (b) the protein contains a sequence which is at least 70% homologous with the amino acid sequence shown as the SEQ ID NO.22. The coding gene provided by the invention is deoxyribonucleotide meeting the following conditions (1), (2) and (3): (1) the deoxyribonucleotide contains the amino acid sequence shown as SEQ ID NO.20; (2) the deoxyribonucleotide contains the amino acid sequence shown as SEQ ID NO.21; and (3) the deoxyribonucleotide contains a sequence which is at least 705 homologous with the amino acid sequence shown as the SEQ ID NO.20 and the SEQ ID NO.21. The recombinant host cell provided by the invention comprises a recombinant expression vector containing the coding gene. An optimum temperature of glucamylase provided by the invention is higher than 70 DEG C, thermal stability of the glucamylase is good, and industrial application requirement is met. The recombinant host cell provided by the invention is applicable to expression of the glucamylase gene; expression is induced by shaking a flask, wherein expression quantity of KM71 protein is 0.7g / L; and an industrialization application prospect can be achieved.

Description

technical field [0001] The invention relates to a glucoamylase with better thermal stability, and also relates to the encoding gene and application of the thermostable glucoamylase. Background technique [0002] Glucoamylase (α-1,4-Glucanglucohydrolases, EC3.2.1.3) is an exo-active glycosidase, which can use starch, dextrin and other polysaccharides or oligosaccharide carbon chains as substrates to convert from non-reducing glucoamylases. End-to-end hydrolysis of α-1,4-glucosidic bonds one by one to generate β-D-glucose, and can also slowly hydrolyze α-1,6-glucosidic bonds of amylopectin to generate glucose. It is one of the main enzymes in the process of hydrolyzing starch to generate glucose. First, it has important commercial value in the fields of food processing, ethanol production and brewing. [0003] The glucoamylase currently used in the market is basically produced by fermentation of Aspergillus niger. Although the enzyme activity is high, the optimum temperature ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/34C12N15/56C12N15/81C12N1/19C12R1/84
Inventor高蓓魏东芝何正贵
OwnerEAST CHINA UNIV OF SCI & TECH