Plant flavonoid synthesis regulation gene and its application

A flavonoid and gene technology, applied in the field of plant genetic engineering and biology, can solve the problem that the synthesis of active ingredient flavonoids and the molecular mechanism of regulation are very few and other problems.

Inactive Publication Date: 2014-04-09
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are very few studies on the synthesis and regulation molecular mechanisms of effective constituents of flavonoids in Epimedium

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant flavonoid synthesis regulation gene and its application
  • Plant flavonoid synthesis regulation gene and its application
  • Plant flavonoid synthesis regulation gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1: the isolated clone of EsMYBA1 gene

[0042] The EsMYBA1 gene was isolated from Epimedium sagittatum by homologous cloning combined with RACE technology, and the process was as follows:

[0043] First, total RNA was extracted from the young leaves of Epimedium sagittatum according to the operating instructions of the RNAiso plus reagent (Takara company, the same below). The specific method is as follows: Take 50-100mg of fresh tissue or frozen tissue, fully grind it in liquid nitrogen, transfer the powder to a 1.5mL centrifuge tube, add 1mL RNAiso plus reagent to fully lyse, and go through chloroform layering, isopropanol precipitation and ethanol Wash and finally dissolve in 50uL of RNase-free ddH 2 O middle. The quality and yield of the RNA solution was detected by gel electrophoresis and UV spectrophotometer Nanodrop2000c (ThermoFisher scientific company, the same below), which met the requirements of reverse transcription, and then stored at -20oC for...

Embodiment 2

[0049] Embodiment 2: subcellular localization

[0050] First, the complete ORF of the EsMYBA1 gene was transferred to the cloning vector pBI221-GFP containing the GFP reporter gene by enzyme-cut ligation, and then the onion epidermal cells were bombarded with a gene gun, observed and photographed under a confocal laser microscope. The vector construction process for subcellular localization analysis is as follows: design a pair of GSP (forward primer: GC GGATCC ATGAAGCCAGATTTTAGTGAGAT, underlined BamHI restriction site; reverse primer: 5'CG GTC GAC TTCAAAATTCCAAAAGTTCAAG, the underlined SalI restriction site), using the recombinant plasmid pMD19-T containing the full-length sequence of EsMYBA1 as a template, amplified its ORF with high-fidelity PrimeStar DNA polymerase, and the PCR system was as described in Example 1. Direct PCR product recovery, BamHI and SalI double digestion, the target fragment recovered after digestion was connected to the cloning vector pBI221-GFP (c...

Embodiment 3

[0051] Embodiment 3: yeast two-hybrid

[0052] In order to verify whether EsMYBA1 has the ability to interact with other bHLH TFs that regulate flavonoid synthesis, we used yeast two hybrid assay (yeast two hybrid) for analysis. The yeast two-hybrid vectors used are pAD-GAL4-2.1 and pBD-GAL4Cam (Stratagene, abbreviated as pAD and pBD, the same below), which contain the AD (activating domain) and BD (binding domain) of the GAL4 protein, respectively. , binding domain), all located under the ADH1 (alcohol dehydrogenase 1, alcohol dehydrogenase 1) promoter. Firstly, the ORF of EsMYBA1 was cloned into pAD and pBD vectors by double enzyme digestion EcoRI / SalI to obtain recombinant vectors pAD-EsMYBA1 and pBD-EsMYBA1, and the recombinant plasmids were digested, identified by PCR and sequencing. The primers used to amplify the ORF of EsMYBA1 are GC GAATTC ATGA AGCCAGATTTTAGTGAGAT (underlined EcoRI restriction site) and CG GTC GAC TTCAAAAATTCCAAAAGTTCAAG (the underline is the Sal...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant flavonoid synthesis regulation gene and its application. CDNA obtained through the inverse transcription of the total RNA of Epimedium brevicornum Maxim blades is treated as a template and undergoes PCR to obtain a 233bp fragment, the 233bp fragment has a very high homology with flavonoid related R2R3-MYB gene, a full-length cDNA sequence is obtained through an RACE technology and is named EsMYBA1 gene, and the sequence of the EsMYBA1 gene is represented by SEQIDNO.1. The EsMYBA1 gene codes an R2R3-MYB transcription factor which has an about 50% homology with other MYB regulation genes for controlling the flavonoid synthesis approaches, and the improvement of the expression level of the EsMYBA1 gene through a genetic engineering technology promotes the synthesis and the accumulation of anthocyanidin.

Description

technical field [0001] The invention belongs to the fields of plant genetic engineering and biotechnology. It specifically relates to the isolation, cloning, functional verification and application of a gene EsMYBA1 that regulates the synthesis pathway of epimedium flavonoids. EsMYBA1 has the function of regulating the expression of genes related to the flavonoid biosynthesis pathway, thereby changing the flavonoid biosynthesis. The invention also relates to the application of the EsMYBA1 gene in changing the synthetic metabolism of plant flavonoids. Background technique [0002] Epimedium is a perennial herb belonging to the genus Epimedium in the family Berberidaceae. Epimedium has a history of more than 2,000 years as a nourishing Chinese medicine. It was first recorded in "Shen Nong’s Herbal Classic", and it is one of the most widely used and longest-standing Chinese herbal medicines in China (Guo Baolin, Xiao Peigen. Review of the main types of Chinese medicine Epimed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C07K14/415A01H5/00
Inventor王瑛黄文俊孙伟吕海燕
OwnerWUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI