Method for producing r-acetoin by Klebsiella pneumoniae

A kind of technology of pneumonia bacillus and acetoin is applied in the field of production of R-acetoin to achieve the effects of high conversion rate, high optical purity and high final concentration

Active Publication Date: 2014-10-15
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] At present, in the biological production method of acetoin, the use of Klebsiella pneumoniae to ferment and produce R-acetoin with high optical purity has not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing r-acetoin by Klebsiella pneumoniae
  • Method for producing r-acetoin by Klebsiella pneumoniae
  • Method for producing r-acetoin by Klebsiella pneumoniae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026]The Klebsiella pneumoniae CGMCC1.6366budC mutant strain was used to ferment glucose to produce R-acetoin. The CGMCC1.6366 strain in this example was preserved by the China General Microorganism Culture Collection and Management Center, and had ampicillin resistance.

[0027] 1. Construction of Klebsiella pneumoniae CGMCC1.6366budC mutant strain

[0028] Proceed as follows:

[0029] 1. Use PCR to amplify Klebsiella pneumoniae acetoin reductase (budC) and the upstream and downstream adjacent sequences, connect to the cloning vector by TA cloning method, and perform DNA sequence determination.

[0030] According to the genome information of Klebsiella pneumoniae MGH78578 (Genbank: CP000647), acetoin reductase PCR primers were designed, the upstream primer budC-s: GCCATCCAGGAAGAGAAAAAATATCA (shown in SEQ ID NO.1), the downstream primer budC-a: AGACGTTTGTACGCCTGGGTAGAAG ( shown in SEQ ID NO.2).

[0031] Using the above primers, Klebsiella pneumoniae CGMCC1.6366 genomic DNA ...

Embodiment 2

[0064] 1) Prepare seed medium

[0065] Peptone 10g / L, yeast powder 5g / L, sodium chloride 5g / L, prepared with tap water, dispensed into 250mL Erlenmeyer flasks with a liquid volume of 50mL, and sterilized.

[0066] 2) Allocation of glucose and other components into fermentation medium

[0067] Glucose monohydrate 50g / L, corn steep liquor powder 5g / L, sodium nitrite 0.1g / L, diammonium hydrogen phosphate 3.3g / L, dipotassium hydrogen phosphate 13.7g / L, potassium dihydrogen phosphate 2.0g / L, sulfuric acid Magnesium 0.25g / L, ferrous sulfate 0.05g / L, manganese sulfate 0.001g / L, trace element solution 1mL / L medium, tap water to prepare 3L, put into a 5L stirred fermenter, and sterilize. After sterilization, the measured glucose content was 42.7g / L.

[0068] Among them, the formula of trace element solution is: zinc chloride 70mg / L, sodium molybdate 35mg / L, boric acid 60mg / L, cobalt chloride 200mg / L, copper sulfate 29.28mg / L, nickel chloride 25mg / L.

[0069] 3) Seed culture

[0070...

Embodiment 3

[0075] 1) Prepare seed medium

[0076] Peptone 10g / L, yeast powder 5g / L, sodium chloride 5g / L, prepared with tap water, dispensed into 250mL Erlenmeyer flasks with a liquid volume of 50mL, and sterilized.

[0077] 2) Allocation of glucose and other components into fermentation medium

[0078] Glucose monohydrate 100g / L, peptone 10g / L, ammonium nitrate 5.5g / L, diammonium hydrogen phosphate 3.3g / L, dipotassium hydrogen phosphate 13.7g / L, potassium dihydrogen phosphate 2.0g / L, trace element solution 1mL / L medium, tap water to prepare 3L, put into a 5L stirred fermenter, and sterilize. After sterilization, the measured glucose content was 88g / L.

[0079] Among them, the formula of trace element solution is: zinc chloride 70mg / L, sodium molybdate 35mg / L, boric acid 60mg / L, cobalt chloride 200mg / L, copper sulfate 29.28mg / L, nickel chloride 25mg / L.

[0080] 3) Seed culture

[0081] Insert the Klebsiella pneumoniae CGMCC1.6366-budC- bacterial lawn prepared in Example 1 into the E...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing R-acetoin from klebsiella pneumoniae. Under an aerobiotic condition, the R-acetoin is produced from the klebsiella pneumoniae which is deactivated by an acetoin reductase gene budC through fermentation. The method provided by the invention has the advantages that the raw material is reproducible carbon source and the conversion rate of the raw material is high, the final concentration of the product R-acetoin is high, and the produced R-acetoin has very high optical purity and the content of R-isomers in the total acetoin is greater than 98%.

Description

technical field [0001] The present invention relates to a method for producing R-acetoin, in particular to a method for producing R-acetoin by using Klebsiella pneumoniae. Background technique [0002] The chemical name of acetoin is 3-hydroxy-2-butanone, which naturally exists in fruits such as corn, apples, bananas and grapes in nature, and also exists in foods such as cheese and meat. Acetoin has a special fragrance and is a safe food additive as a flavoring. Acetoin is used as a flavor enhancer for butter, cheese, coffee, etc., as well as flavors for preparing cream and yogurt [Han Li, Zhao Xiangying, Liu Jianjun. Properties, production and application of acetoin. Journal of Shandong Institute of Light Industry, 2007, 21 (4 ), 80-83]. [0003] At present, there are two main methods for the synthesis of acetoin, chemical synthesis and biosynthesis. The raw materials used in the chemical synthesis method include 2,3-butanedione (diacetyl), 2,3-butanediol and acetaldehyd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P7/26C12R1/22
Inventor郝健魏东陈川史吉平姜标
OwnerSHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI