Expression element composed of aspergillus niger and expression vector composed of expression element, and recombined aspergillus niger and construction method and application thereof
A technology for constitutive expression and expression vector, which is applied in the field of genetic engineering research to achieve the effect of saving production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Acquisition of promoter and terminator sequences of transcription elongation factor gene of Aspergillus niger
[0030] Inoculate Aspergillus niger (purchased from the Microbial Strain Collection Center of Guangdong Institute of Microbiology) on PDA solid medium and culture at 28°C until the spores mature. Take an appropriate amount of spores to prepare a suspension and inoculate it in liquid PDA. Cultured at 28°C and 200rpm for 3 days, and the mycelium was harvested for extraction of A. niger genomic DNA.
[0031] Aspergillus niger genome was extracted by benzyl chloride method: mix the mycelia with SDS and benzyl chloride, heat at 50°C, then add 3M sodium acetate solution and mix well, bathe in ice water for 15 minutes, centrifuge for 15 minutes, take the supernatant, add an equal volume Precipitate with isopropanol at room temperature for 20 min. After high-speed centrifugation at room temperature for 15 minutes, the precipitate was washed once with 70% ethanol, drie...
Embodiment 2
[0037] Acquisition of the promoter and terminator sequences of pyruvate kinase gene from Aspergillus niger
[0038] According to the Aspergillus niger pyruvate kinase gene information published by Genbank (accession number: S38698), primers were designed to amplify its promoter and transcription termination sequence. The promoter element sequence of Aspergillus niger pyruvate kinase gene is shown in SEQ ID NO.7. The subelement sequence is shown in SEQ ID NO.8. The primer sequences are as follows:
[0039] Table 2 Primer Information List
[0040]
[0041] Using Takara's PrimeSTAR high-fidelity DNA polymerase, the extracted Aspergillus niger genome was used as a template, and amplified according to the conditions of the polymerase instructions. The size of the PCR product was detected by agarose nucleic acid electrophoresis and verified by sequencing.
Embodiment 3
[0043] Construction of Aspergillus niger constitutive expression vector
[0044] Design specific amplification primers according to the Amds gene sequence, the sequence is as follows: Amds-F:
[0045] GGGGTACCTTTTGAATAGCTCGCCCGCT (KpnI); Amds-R:
[0046] CCGCTCGAGCTAGACTGGAAACGCAACCC (XhoI), using Amds-F and Amds-R, and using the commercial pKLAC1 vector containing Amds gene (New England Biolabs, USA) to amplify the Amds gene fragment, the Amds gene sequence is shown in SEQ ID NO.9. The Amds gene fragment was digested with KpnI and XhoI, and cloned into the commercial vector pbluscript (Stratagene, USA) to obtain an intermediate vector pbluscript-Amds. In order to obtain the expression vector containing the transcription elongation factor gene expression element, its promoter gene fragment P tef 1490、P tef 990.P tef 690 and P tef 390 were digested with XhoI and HindIII respectively, and cloned into the intermediate vector pbluescript-Amds to obtain pbluescript-P tef 1490...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com