Recombinant expression vector and application thereof
A technology of expression vectors and mutants, applied in the field of biocatalysis, can solve the problems of long production cycle, low substrate conversion rate, and difficult product separation and extraction, and achieve elimination of substrate inhibition, high bacterial activity, and improvement of whole-cell biocatalysis. The effect of conversion efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1, the construction of producing 1,5-pentanediamine bacterial strain
[0042] According to E. coli E. coli BL21 (DE3) (GenBank: AM946981.2) lysine-cadaverine antiporter gene cadB gene and lysine decarboxylase gene cadA sequence design primers:
[0043] CadB-BamHI-ET-F: CGCGGATCCTATGAGTTCTGCCAAG;
[0044] CadB-HindIII-ET-R: CCCAAGCTTTTAATGTGCGTTAGACG;
[0045] CadA-NdeI-Duet-F: GGAATTCCATATGAACGTTATTGCAATATTG;
[0046] CadA-kpnI-Duet-R: GGGGTACCTTATTTTTTGCTTTCTTCTTTC.
[0047] The cadB gene obtained by PCR was first inserted into the pET-22b vector Bam H I and Hind Between sites III, the plasmid pET22b-cadB was constructed. The cadA gene obtained by PCR was inserted into the pETDuet-1 vector Nde I and Kpn Between the I sites, the plasmid pETDuet-CadA was constructed. Then, use Hind III and Xba I digested to get the plasmid pET22b-cadB pelB -CadB fragment and inserted into plasmid pETDuet-CadA Hind III- Xba Between the I sites...
Embodiment 2
[0049] Embodiment 2, test of genetically engineered bacteria fermented liquid transformation production 1,5-pentanediamine
[0050] Pick a single colony and place it in 5 ml LB liquid medium containing 100 ug / ml ampicillin, activate the strain overnight at 37°C and 200 rpm. The activated strains were transferred to 50 ml liquid fermentation medium containing 100 ug / ml ampicillin at 1% inoculum, and cultured at 37°C and 200 rpm until the OD600 was about 0.5. Add IPTG to a final concentration of 0.5 mM, and add substrate L-lysine hydrochloride to a final concentration of 12.5 g / l (equivalent to a concentration of L-lysine of 10 g / l), induce culture at 30 °C and 200 rpm 12h. The composition of the fermentation medium was: yeast extract 0.5 g / l, peptone 1.0 g / l, NaCl 0.5 g / l, 3-(N-morpholino)propanesulfonic acid sodium salt (MOPS) 100 mM, pH 7.6.
[0051] The content of L-lysine in the transformation solution was detected by a SBA-40E biosensor. The content of 1,5-pentanedia...
Embodiment 3
[0055] Embodiment 3, whole cell transformation test under different substrate concentrations
[0056] Pick a single colony and place it in 5 ml LB liquid medium containing 100 ug / ml ampicillin, activate the strain overnight at 37°C and 200 rpm. The activated strains were transferred to 50 ml liquid fermentation medium containing 100 ug / ml ampicillin at 1% inoculum, and cultured at 37°C and 200 rpm until the OD600 was about 0.5. Add IPTG to a final concentration of 0.5 mM, induce culture at 30 °C, 200 rpm for 6 h, then centrifuge at 10,000 × g for 10 min to collect the cells, and resuspend the cells in Na 2 HPO 4 - in citrate buffer (pH 5.6) for whole cell transformation assays. The composition of the fermentation medium was: yeast extract 0.5 g / l, peptone 1.0 g / l, NaCl 0.5 g / l, 3-(N-morpholino)propanesulfonic acid sodium salt (MOPS) 100 mM, pH 7.0.
[0057] The whole cell transformation system includes: bacteria 0.4 g, pyridoxal phosphate (PLP) 0.01 mM, Fe 2+ 10 mM, the...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap