Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant expression vector and application thereof

A technology of expression vectors and mutants, applied in the field of biocatalysis, can solve the problems of long production cycle, low substrate conversion rate, and difficult product separation and extraction, and achieve elimination of substrate inhibition, high bacterial activity, and improvement of whole-cell biocatalysis. The effect of conversion efficiency

Inactive Publication Date: 2015-04-08
NANJING UNIV OF TECH
View PDF1 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with the fermentation method, whole-cell catalysis overcomes the shortcomings of the fermentation method, such as long production cycle, complex metabolites, low substrate conversion rate, difficult product separation and extraction, and high energy consumption.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression vector and application thereof
  • Recombinant expression vector and application thereof
  • Recombinant expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the construction of producing 1,5-pentanediamine bacterial strain

[0042] According to E. coli E. coli BL21 (DE3) (GenBank: AM946981.2) lysine-cadaverine antiporter gene cadB gene and lysine decarboxylase gene cadA sequence design primers:

[0043] CadB-BamHI-ET-F: CGCGGATCCTATGAGTTCTGCCAAG;

[0044] CadB-HindIII-ET-R: CCCAAGCTTTTAATGTGCGTTAGACG;

[0045] CadA-NdeI-Duet-F: GGAATTCCATATGAACGTTATTGCAATATTG;

[0046] CadA-kpnI-Duet-R: GGGGTACCTTATTTTTTGCTTTCTTCTTTC.

[0047] The cadB gene obtained by PCR was first inserted into the pET-22b vector Bam H I and Hind Between sites III, the plasmid pET22b-cadB was constructed. The cadA gene obtained by PCR was inserted into the pETDuet-1 vector Nde I and Kpn Between the I sites, the plasmid pETDuet-CadA was constructed. Then, use Hind III and Xba I digested to get the plasmid pET22b-cadB pelB -CadB fragment and inserted into plasmid pETDuet-CadA Hind III- Xba Between the I sites...

Embodiment 2

[0049] Embodiment 2, test of genetically engineered bacteria fermented liquid transformation production 1,5-pentanediamine

[0050] Pick a single colony and place it in 5 ml LB liquid medium containing 100 ug / ml ampicillin, activate the strain overnight at 37°C and 200 rpm. The activated strains were transferred to 50 ml liquid fermentation medium containing 100 ug / ml ampicillin at 1% inoculum, and cultured at 37°C and 200 rpm until the OD600 was about 0.5. Add IPTG to a final concentration of 0.5 mM, and add substrate L-lysine hydrochloride to a final concentration of 12.5 g / l (equivalent to a concentration of L-lysine of 10 g / l), induce culture at 30 °C and 200 rpm 12h. The composition of the fermentation medium was: yeast extract 0.5 g / l, peptone 1.0 g / l, NaCl 0.5 g / l, 3-(N-morpholino)propanesulfonic acid sodium salt (MOPS) 100 mM, pH 7.6.

[0051] The content of L-lysine in the transformation solution was detected by a SBA-40E biosensor. The content of 1,5-pentanedia...

Embodiment 3

[0055] Embodiment 3, whole cell transformation test under different substrate concentrations

[0056] Pick a single colony and place it in 5 ml LB liquid medium containing 100 ug / ml ampicillin, activate the strain overnight at 37°C and 200 rpm. The activated strains were transferred to 50 ml liquid fermentation medium containing 100 ug / ml ampicillin at 1% inoculum, and cultured at 37°C and 200 rpm until the OD600 was about 0.5. Add IPTG to a final concentration of 0.5 mM, induce culture at 30 °C, 200 rpm for 6 h, then centrifuge at 10,000 × g for 10 min to collect the cells, and resuspend the cells in Na 2 HPO 4 - in citrate buffer (pH 5.6) for whole cell transformation assays. The composition of the fermentation medium was: yeast extract 0.5 g / l, peptone 1.0 g / l, NaCl 0.5 g / l, 3-(N-morpholino)propanesulfonic acid sodium salt (MOPS) 100 mM, pH 7.0.

[0057] The whole cell transformation system includes: bacteria 0.4 g, pyridoxal phosphate (PLP) 0.01 mM, Fe 2+ 10 mM, the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological catalysis and particularly relates to a recombinant expression vector, genetically engineered bacteria containing the recombinant expression vector and a method for producing 1,5-pentanediamine by virtue of whole cell conversion of the recombinant expression vector. The recombinant expression vector comprises a nucleotide sequence for expressing cadB and a nucleotide sequence for expressing cadA of lysine decarboxylase, wherein two nucleotide sequences are respectively regulated, controlled and transcribed by one independent promoter. The recombinant expression vector is characterized in that a periplasm secreting signal peptide coding sequence is fused to a terminal 5' of the nucleotide sequence for expressing cadB. The activity of the thallus of the genetically engineered bacteria is high; preliminary study finds that by carrying out whole cell conversion on a 343g / l substrate, the content of 1,5-pentanediamine reaches 221 g / l and is far superior to that in the report of the prior art.

Description

technical field [0001] The invention relates to the technical field of biocatalysis, in particular to an expression recombinant vector, a genetically engineered bacterium containing the same and a method for producing 1,5-pentanediamine by transforming whole cells thereof. Background technique [0002] 1,5-Pentanediamine (pentamethylenediamine for short), that is, cadaverine, is a nitrogenous base with biological activity that exists widely in organisms. It is produced when lysine undergoes decarboxylation under the action of decarboxylase when protein decays. product. In agriculture, 1,5-pentanediamine can be used to regulate the aging process of plants, promote the development of pistils, improve the development of plant fruits, and increase fruit yield; in medicine, it can also be used as an effective drug ingredient for treating dysentery; in industry It is an extremely important chemical raw material. It can be polymerized with dibasic acids such as adipic acid, succin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N1/21C12P13/00
Inventor 陈可泉马伟超曹伟佳李艳张弘欧阳平凯
Owner NANJING UNIV OF TECH