Unlock instant, AI-driven research and patent intelligence for your innovation.

Antarctic-derived Bacillus sp.N311 and application of Bacillus sp.N311 for preventing and treating phytopathogenic fungi

A bacillus and phytopathogenic technology, applied in applications, plant growth regulators, botanical equipment and methods, etc., can solve problems such as ecological environment and human health hazards, plant pathogenic bacteria resistance, etc., and achieve a broad antifungal spectrum, Good biological control effect and simple preparation process

Active Publication Date: 2016-03-23
THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, due to the extensive use of chemical pesticides, it not only brings about the problem of resistance of plant pathogenic bacteria, but also causes potential harm to the ecological environment and human health.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antarctic-derived Bacillus sp.N311 and application of Bacillus sp.N311 for preventing and treating phytopathogenic fungi
  • Antarctic-derived Bacillus sp.N311 and application of Bacillus sp.N311 for preventing and treating phytopathogenic fungi
  • Antarctic-derived Bacillus sp.N311 and application of Bacillus sp.N311 for preventing and treating phytopathogenic fungi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Isolation and screening of Bacillus sp. N311

[0026] The present invention relates to bacillus (Bacillus sp.) N311 obtained by screening from the seawater samples collected by the applicant during the 31st Antarctic scientific expedition in China. The bacterium grows on LB medium, and after 24 hours of culture at 28°C, the bacterium is pale yellow, the surface of the colony is rough and dry, and the edges are irregular, see figure 1 .

Embodiment 2

[0027] Embodiment 2: Bacillus sp. (Bacillus sp.) N311 strain identification

[0028] The 16S rDNA universal primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT) were used to amplify the Antarctic strain N31116SrDNA sequence. The total DNA of N311 was used as the PCR amplification template, and the PCR reaction was carried out on a PCR amplification instrument. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. After the amplified sequence was sequenced by a sequencing company, the 16S rDNA sequence of the strain was obtained. The sequence was compared with the nucleic acid data in GenBank of the National Center for Biotechnology Information (http: / / ncbi.nlm.nih.gov / blast). The results showed that the 16S rDNA sequence of N311 had a sequence similarity of 99% with Bacillus methylotrophicus (HQ662596.1), Bacillus amyloliquefaciens (JF460737.1), and Bacillus amyloliquefa...

Embodiment 3

[0029] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum

[0030] The inhibitory activity of Bacillus sp. N311 against 10 plant pathogenic fungi was determined by disc method. Use a sterile puncher to make the test pathogenic fungus into a bacterial block, pick a bacterial block with a toothpick and inoculate it in the center of the potato solid medium plate, and cultivate it under the condition of 28°C. After the mycelium of the pathogenic fungus to be tested spreads and grows, a sterilized double-layer filter paper sheet (diameter 6 mm) is placed around the bacterial block, and the filter paper sheet is about 1 cm away from the edge of the mycelium. Add 50 μL of sterile fermentation supernatant to each filter paper sheet, and continue to cultivate for 24 hours. By comparing with the control group, observe whether the growth of mycelium will be inhibited. If the mycelium of the tested pathogenic fungus is inhibited, the bacteria The filaments will...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to Antarctic-derived Bacillus sp.N311 and an application of Bacillus sp.N311 for preventing and treating phytopathogenic fungi, which relate to Bacillus sp. A preservation number of the Bacillus sp.N311 is CCTCC NO: M 2015607. The Bacillus sp.N311 can be used for preparing a fermentation supernatant for preventing and treating phytopathogenic fungi. The phytopathogenic fungi comprise fusarium, gloeosporium musarum, Paecilomyces variotii, sclerotinia sclerotiorum, Alternaria longipes, Trichoderma viride, Rhizoctonia solani, alternaria alternate, botrytis cinerea and Colletotrichum gloeosporioides. The Bacillus sp.N311 has good biological prevention and treatment effects in Rape Sclerotinia Rot pot culture prevention and treatment tests, and prevention and treatment effects can reach more than 50%. The Bacillus sp.N311 fermentation supernatant has wide fungus-inhibiting spectrum and good biocontrol effect, has advantages of no toxicity, difficult generation of drug resistance, environment safety and biosafety, and has wide application prospect.

Description

technical field [0001] The invention relates to a bacillus, in particular to a bacillus N311 and its application in preparing a fermentation supernatant for preventing and controlling plant pathogenic fungi. Background technique [0002] Plant disease is an important factor that seriously threatens agricultural production. According to the statistics of the Food and Agriculture Organization of the United Nations (FAO), the average annual production loss caused by plant disease is 10% to 15% of the total output. At present, due to the extensive use of chemical pesticides, it not only brings about the problem of resistance of plant pathogenic bacteria, but also causes potential harm to the ecological environment and human health. The development of broad-spectrum, high-efficiency, and low-toxicity biological pesticides has become a common goal of researchers and pesticide users (CalvoJ, CalventeV, et al.2007). [0003] In recent years, the discovery of active substances with ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/02A01P3/00C12R1/07
CPCA01N63/10C12N1/205C12R2001/07
Inventor 陈新华吴小君郭文斌
Owner THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More