Method for producing 1,3-propylene glycol through fermentation via recombinant microbes

A technology for recombining microorganisms and propylene glycol, applied in the fields of genetic engineering and biological fermentation, can solve the problems of poor biosafety of Escherichia coli, complicated post-extraction process, unfavorable large-scale production, etc. less effect

Pending Publication Date: 2017-06-30
GUANGDONG TSINGDA SMART BIOTECH CO LTD
View PDF13 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main disadvantages of this process route are: 1. Klebsiella pneumoniae is an opportunistic pathogen, and its biological safety needs to be strictly controlled in the production process; 2. A large number of by-products such as acetic acid, lactic acid, succinic acid, 2,3 -The synthesis of butanediol makes the whole post-extraction process very complicated; the yield of three and 1,3-propanediol is low, usually the mass yield of 1,3-propanediol to glycerin is lower than 40%
The disadvantage of this process route is that Escherichia coli has poor biological safety, and the fermentation and cultivation of Escherichia coli requires the use of expensive raw material yeast powder, so this technology is not conducive to industrial scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing 1,3-propylene glycol through fermentation via recombinant microbes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Overexpression of the dihydroxyacetone phosphate phosphatase gene and the glycerol dehydrogenase gene gldA derived from Escherichia coli

[0035] Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, primers hdpA-F (cagctatgaccatgattacgATAAGGCTGATTAGCGGGAAAATTTCG) and hdpA-R (CCAGTCGTGTCTAGTCAGTGAACTGCTGCTCATCT) were used as primers to perform PCR to obtain hdpA gene (hdpA gene sequence such as SEQ ID NO.1) about 0.9kb And perform PCR product purification.

[0036] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers gldA-F (CACTGACTAGACACGACTGGAATGCCGC) and gldA-R (atccccgggtaccgagctcgttaTTCCCACTCTTGCAGGAAACGC) as primers to obtain about 1.2 kb of the gldA gene (gldA gene sequence such as SEQ ID NO.2) and perform PCR product purification.

[0037] The Escherichia coli-Corynebacterium glutamicum shuttle plasmid pEC-K18mob2 (Journal of Biotechnology 104 (2003) 287-299) was digested with EcoRI, and the hpd...

Embodiment 2

[0039] Example 2 Overexpression of glycerol dehydratase derived from Klebsiella pneumoniae and its activator pduCDEGH and alcohol dehydrogenase gene yqhD from Escherichia coli

[0040] Using the genome of Klebsiella pneumoniae HR526 as a template, primers pdu-F (CGCCCGCtaaAAGGAGATACCATGAGATCGAAAAGATTTGAAG) and pdu-R (tgcctgcaggtcgactctagTTAAGCATGGCG) were used as primers to carry out PCR to obtain a pduCDEGH operon fragment comprising glycerol dehydratase and its activator (sequence such as shown in SEQ ID NO.3) and perform PCR product purification.

[0041] Using the genome of Escherichia coli MG1655 as a template, PCR was carried out with primers yqhD-F (ctatgacatgattacgaattAAGGAGATATACCatgAACAACTTTAATCTGCAC) and yqhD-R (ATATCTCTTttaGCGGGCGGCTTCG) as primers to obtain the alcohol dehydrogenase gene yqhD fragment (sequence shown in SEQ ID NO.4) and purify .

[0042] The Escherichia coli-Corynebacterium glutamicum shuttle plasmid pXMJ19 [disclosed in Jakoby, M.J., Ngouto-Nkil...

Embodiment 3

[0044] The fermentation culture of embodiment 3 recombinant Corynebacterium glutamicum

[0045] The wild strain of Corynebacterium glutamicum ATCC13032 and the recombinant strain C.glutamicum / pEC-hdpA-gldA obtained in Example 1, the recombinant strain C.glutamicum / pEC-hdpA-gldA / pXMJ-yqhD- pdu were cultured overnight on LB plates. Single bacterium colonies were inoculated from the fresh plate into a 250 ml shaker flask with baffles containing 30 ml of seed medium, and cultured at 32° C. at 200 rpm for 12 hours.

[0046] The formulation of the seed medium includes (g / L): Glucose 25, (NH 4 ) 2 SO 4 5.0,K 2 HPO 4 1.5, MgSO 4 1.0,MnSO 4 0.005,FeSO 4 0.005, corn steep liquor 30, kanamycin 0.025.

[0047] Inoculate the seed liquid into 2L fermentation medium with 10% inoculum amount, use a 5L fermenter for fermentation, control the temperature at 32°C, the ventilation rate at 1vvm, adjust the speed to keep the dissolved oxygen level above 10%, and feed Ammonia water co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing 1,3-propylene glycol through fermentation via recombinant microbes. According to the invention, an endogenous dihydroxypropanone phosphatein phosphatase gene hdpA is over-expressed in Corynebacterium glutamicum to reinforce removal of phosphoric acid from dihydroxypropanone phosphatein so as to produce dihydroxypropanone; exogenous glycerol dehydrogenase is introduced to convert dihydroxypropanone into glycerin; and glycerin finally produces 1,3-propylene glycol under the action of exogenous glycerol dehydratase and an activator thereof and alcohol dehydrogenase. Corynebacterium glutamicum can use different cheap raw materials for fermentation, and cheap corn steep liquor can be used as a nutritional component to replace expensive yeast powder, so cost for raw materials is further reduced, and the problems in biosecurity and tolerance of the bacterial strain to a substrate and a product are overcome; and thalli obtained in the process of fermentation can be used as a product for a feed additive. The method provided by the invention produces few by-products and can further simplify the separating process of 1,3-propylene glycol.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and biological fermentation, in particular, a method for efficiently bioconverting fermentable sugar into 1,3-propanediol by a single recombinant microorganism. Background technique [0002] 1,3-Propanediol is an important chemical raw material, which can be used as an organic solvent in ink, printing and dyeing, paint, lubricant, antifreeze and other industries. Its main use is as a monomer for the synthesis of polyester and polyurethane. Especially polymerized with terephthalic acid to form polytrimethylene terephthalate (PTT). Compared with PET (polyethylene terephthalate), PBT (polybutylene terephthalate), PTT has better properties, such as better stain resistance, toughness and resilience, and UV resistance In addition, it has the advantages of wear resistance, low water absorption and low static electricity. Therefore, PTT is considered as an upgraded product of PET and has bro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/18C12R1/15C12R1/19C12R1/125C12R1/865
CPCC12P7/18
Inventor陈振刘德华
OwnerGUANGDONG TSINGDA SMART BIOTECH CO LTD