Unlock instant, AI-driven research and patent intelligence for your innovation.

Rabies virus rapid antibody quantitative detection card and application method thereof

A rabies virus, quantitative detection technology, applied in the field of detection cards, can solve the problems of low sensitivity, only qualitative, narrow detection range, etc., and achieve the effects of high sensitivity, improved sensitivity, and small intra-batch variation

Inactive Publication Date: 2018-03-30
杭州微瑞科技有限公司
View PDF15 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] ELISA kits for the detection of rabies virus antibodies are used in the market. ELISA kits require microplate readers, incubation reaction conditions, plate washing conditions, operating working environment and professional technicians. In addition, the detection samples also require complex pre-treatment, such as blood collection. , separation of serum, etc.; and rapid colloidal gold although detection is convenient, does not require professional technicians and working environment, but its detection sensitivity is low, and it can only be qualitative, and the detection range is narrow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rabies virus rapid antibody quantitative detection card and application method thereof
  • Rabies virus rapid antibody quantitative detection card and application method thereof
  • Rabies virus rapid antibody quantitative detection card and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, eukaryotic expression of rabies virus structural protein G protein

[0036] Step 1, primer design and vector construction: according to the rabies virus RVG gene sequence published in the GenBank (EU126641.1) database, design primers to amplify the G sequence, and design its upstream and downstream primers; the upstream primer F is 5'CGGGATCCATGGTTCCTCAGGTTCTTTTG-3 The 5' end of 'contains an Xho1 restriction site, and the downstream primer R is 5'CGGGGTACCCTAATGGTGGTGATGGTGCAGTCTGATCTCACCTCCACT 3'The 5' end contains a Kpn1 restriction site. Using the synthesized RVG gene as a template and F / R as primers, the G gene was amplified by PCR.

[0037] Step 2. Construction of the recombinant plasmid: Detect the PCR product with 1% agarose gel electrophoresis, and recover the purified G gene fragment with a DNA purification and recovery kit. Perform agarose gel electrophoresis on the recovered fragment to identify whether the band is correct. The vector pEGFP-C1D...

Embodiment 2

[0040] Example 2: Rabies virus structural protein G protein uses specific synthetic peptides to prepare antigens

[0041] A method for preparing the above-mentioned rabies virus structural protein G protein, comprising the following steps:

[0042] Step 1. Sequence analysis of the rabies virus structural protein G protein: use bioinformatics to predict MHC class I molecules: use relevant websites to verify or apply computer software to analyze the sequence of the RV-G protein to understand its hydrophilicity, hydrophobicity, and structural domains Accessibility, sequence variability, α-helix, β-turn, antigenicity and other parameters, and then comprehensive analysis and homology modeling methods to predict its tertiary structure, from which the antigenic reactive epitope and amino acid residues are predicted, and The comprehensive analysis design is carried out according to the degree of difficulty of the peptide synthesizer. Each polypeptide chain contains at least one predi...

Embodiment 3

[0044] Embodiment three, the detection card that prepares rabies virus antibody

[0045] Preparation of rabies virus antibody detection standard curve: prepare 6 copies of calibration solution containing rabies virus antibody (including rabies virus antibody standard), the concentrations are 0, 0.5IU / ml, 1 IU / ml, 2 IU / ml, 5IU / ml , 10IU / ml. Add the above-mentioned calibration solutions of different concentrations into the sample holes of the assembled test card, and after 15 minutes of chromatography, the test is carried out by a tomographic scanner, and the test results obtained 6 times are processed by the client, and the client calculates The fluorescence signal intensity values ​​of the detection line and quality control line corresponding to the standard product, and perform linear regression based on this data to make a standard curve of rabies virus antibody. The standard curve calculated by the client forms a file and generates a barcode correspondingly. The terminal w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rabies virus rapid antibody quantitative detection card and an application method thereof. The rabies virus rapid antibody quantitative detection card comprises a detection card housing and a test strip assembled in the detection card housing, wherein the test strip comprises a plastic baseplate with a pressure-sensitive adhesive; a sample pad, a marker pad, a nitrocellulose membrane and absorbent paper are sequentially bonded on the baseplate; the marker pad consists of a carrier base layer and a marker; the marker is a membrane formed by spraying lanthanide fluorescence detection microspheres and lanthanide fluorescence quality control microspheres onto the carrier base layer; the nitrocellulose membrane is coated with a rabies virus recombinant antigen as a detection line and coated with a rabbit anti-chicken IgY antigen as a quality control line; and the marker is fluorescence detection microspheres marked with a rabies virus structural protein G recombinant antigen and fluorescence quality control microspheres marked with a chicken IgY antibody. The rabies virus rapid antibody quantitative detection card can realize field rapid quantitative detectionof a rabies virus antibody and has a high practical value and popularization value.

Description

technical field [0001] The invention relates to a detection card, in particular to a rapid quantitative detection card for rabies virus antibody and a use method thereof. Background technique [0002] Rabies virus (RV) belongs to the Rhabdoviridae genus Lyssavirus and is the pathogen that causes rabies. The shape is elastic, the nucleocapsid is helical and symmetrical, with an envelope on the surface and contains single-stranded RNA. The virus particle has an envelope outside and a nucleoprotein shell inside. The outermost layer of the capsule has many fibrous protrusions composed of glycoproteins, which are arranged in a relatively orderly manner. These protrusions are antigenic and can stimulate the body to produce neutralizing antibodies. The virus contains 5 major proteins (L, N, G, M1 and M2) and 2 minor proteins (P40 and P43). L protein presents transcription; N protein is the main nucleoprotein that composes virions, and is the main component of inducing rabies cel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569
CPCG01N33/56983
Inventor 吴俊清张岩章健冯烨吴冠英涂长春王泽洲肖红
Owner 杭州微瑞科技有限公司