Rabies virus rapid antibody quantitative detection card and application method thereof
A rabies virus, quantitative detection technology, applied in the field of detection cards, can solve the problems of low sensitivity, only qualitative, narrow detection range, etc., and achieve the effects of high sensitivity, improved sensitivity, and small intra-batch variation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1, eukaryotic expression of rabies virus structural protein G protein
[0036] Step 1, primer design and vector construction: according to the rabies virus RVG gene sequence published in the GenBank (EU126641.1) database, design primers to amplify the G sequence, and design its upstream and downstream primers; the upstream primer F is 5'CGGGATCCATGGTTCCTCAGGTTCTTTTG-3 The 5' end of 'contains an Xho1 restriction site, and the downstream primer R is 5'CGGGGTACCCTAATGGTGGTGATGGTGCAGTCTGATCTCACCTCCACT 3'The 5' end contains a Kpn1 restriction site. Using the synthesized RVG gene as a template and F / R as primers, the G gene was amplified by PCR.
[0037] Step 2. Construction of the recombinant plasmid: Detect the PCR product with 1% agarose gel electrophoresis, and recover the purified G gene fragment with a DNA purification and recovery kit. Perform agarose gel electrophoresis on the recovered fragment to identify whether the band is correct. The vector pEGFP-C1D...
Embodiment 2
[0040] Example 2: Rabies virus structural protein G protein uses specific synthetic peptides to prepare antigens
[0041] A method for preparing the above-mentioned rabies virus structural protein G protein, comprising the following steps:
[0042] Step 1. Sequence analysis of the rabies virus structural protein G protein: use bioinformatics to predict MHC class I molecules: use relevant websites to verify or apply computer software to analyze the sequence of the RV-G protein to understand its hydrophilicity, hydrophobicity, and structural domains Accessibility, sequence variability, α-helix, β-turn, antigenicity and other parameters, and then comprehensive analysis and homology modeling methods to predict its tertiary structure, from which the antigenic reactive epitope and amino acid residues are predicted, and The comprehensive analysis design is carried out according to the degree of difficulty of the peptide synthesizer. Each polypeptide chain contains at least one predi...
Embodiment 3
[0044] Embodiment three, the detection card that prepares rabies virus antibody
[0045] Preparation of rabies virus antibody detection standard curve: prepare 6 copies of calibration solution containing rabies virus antibody (including rabies virus antibody standard), the concentrations are 0, 0.5IU / ml, 1 IU / ml, 2 IU / ml, 5IU / ml , 10IU / ml. Add the above-mentioned calibration solutions of different concentrations into the sample holes of the assembled test card, and after 15 minutes of chromatography, the test is carried out by a tomographic scanner, and the test results obtained 6 times are processed by the client, and the client calculates The fluorescence signal intensity values of the detection line and quality control line corresponding to the standard product, and perform linear regression based on this data to make a standard curve of rabies virus antibody. The standard curve calculated by the client forms a file and generates a barcode correspondingly. The terminal w...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap