Omega-transaminase mutant and application thereof in preparation of sitagliptin intermediate

A technology of sitagliptin and mutants, applied in the application field of preparing sitagliptin intermediate 1-piperidine-4--1,3-dibutanone, can solve the problem of low conversion rate and low yield 14%, limited application, etc., to achieve the effect of improving the overall conversion rate and shortening the reaction time

Active Publication Date: 2019-12-06
ZHEJIANG UNIV OF TECH +2
View PDF7 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this synthesis method, asymmetric hydrogenation catalyzed by ruthenium is required, the catalyst is expensive, the total yield is only 52%, and high-pressure hydrogen is used in the process, and the stereoselectivity is not high
[0006] The international patent application WO2007050485 discloses the synthesis method of the sitagliptin intermediate of Merck, which uses a chiral germanium catalyst to asymmetric hydrogenate enamines to synthesize chiral amines, with a yield of 84% and an ee value of 94%. However, this method requires the use of expensive germanium chiral catalysts, and it is difficult to remove and recover
[0007] Chinese patent application document CN102838511A discloses the production method of sitagliptin intermediate of Zhejiang Haixiang Pharmaceutical Co., Ltd., using Grignard reagent to perform nucleophilic substitution of chiral epichlorohydrin, and then using cyanide to perform substitution hydrolysis to synthesize beta-hydroxy acid. The total yield of this method is only 40%, and highly toxic cyanide is used, so the application is limited
[0008] Chinese patent application document CN102485718A discloses the route of Zhejiang Haixiang Pharmaceutical Co., Ltd. for the synthesis of sitagliptin intermediates, which is synthesized by using methionine as a chiral source, but the yield is only 14%.
[0009] Chinese patent application document CN103014081A discloses that Suzhou Hanzyme Company uses transaminase to transaminate 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester into (R)-3-amino- 4-(2,4,5-trifluorophenyl)-butyric acid methyl ester, but did not disclose the sequence and cloning method of the specific transaminase
However, there are still some ω-transaminases with low enzymatic activity and low conversion rate for specific substrates, especially when the substrate contains large groups such as benzene rings.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Omega-transaminase mutant and application thereof in preparation of sitagliptin intermediate
  • Omega-transaminase mutant and application thereof in preparation of sitagliptin intermediate
  • Omega-transaminase mutant and application thereof in preparation of sitagliptin intermediate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Construction and Screening of AbTA Mutants of Transaminase

[0033] 1. Mutant construction

[0034] According to the parental transaminase base sequence from Arthrobacter cumminsii (sequence shown in SEQ ID NO.2, nucleotide sequence shown in SEQ ID NO:1) included in Genbank for homology modeling and molecular In docking, etc., through a large number of calculations and analysis of 336 amino acids (6720 possible mutation types), the 56th and 134th positions were selected to introduce single mutations, the mutation primers for site-directed mutations were designed, and the rapid PCR technology was used to recombine the vector pETDuet / AbTA. As the template, the primers are:

[0035] Primer 1: F56D Pr CGCATTTCCATCGACGACCAGGGCTTTTAT

[0036] F56D Pf AAAGCCCTGGTCGGTCATGGAAATGCGCGC

[0037] Primer 2: F56H Pr CGCATTTCCATCCACGACCAGGGCTTTTAT

[0038] F56H Pf AAAGCCCTGGTCGGTGATGGAAATGCGCGC

[0039] Primer 3: F56V Pr CGCATTTCCATCGTCGACCAGGGCTTTTAT

[0040] F56V Pf AAAGCCCTGGTCGGACAT...

Embodiment 2

[0056] Example 2 Separation and Purification of Transaminase (AbTA)

[0057] The wet bacteria obtained in Example 1 were resuspended in triethanolamine buffer (0.015g / mL, pH 9.0), then ultrasonically disrupted (under ice bath conditions, 70% power for 15min, work for 1s, pause for 1s), 8000rpm After centrifugation for 10 minutes, the supernatant was incubated with the Ni affinity chromatography resin balanced with the above-mentioned binding solution, and then washed with a washing buffer (50mM, pH8.0 sodium phosphate buffer, containing 300mM NaCl, 50mM imidazole) until almost no impurities The protein was then eluted with elution buffer (50mM, pH 8.0 sodium phosphate buffer, containing 300mM NaCl, 500mM imidazole) and the target protein was collected. After the purity was identified by electrophoresis, the target protein was combined and used in dialysis buffer (0.015g / mL, (pH 9.0 ethanolamine buffer) dialysis for 10h (dialysis bag molecular retention 14KD).

[0058] Coomassie br...

Embodiment 3

[0059] Example 3 Application of wild-type transaminase AbTA in the preparation of sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone

[0060] The recombinant E. coli BL21 / pETDuet-AbTA wet bacteria containing the expression recombinant plasmid obtained by the method of Example 1 or the pure AbTA enzyme obtained by the method of Example 2 was used as a biocatalyst, and sitagliptin intermediate precursor ketone [1- Piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutyl ketone] is used as the substrate to conduct biocatalytic reaction to synthesize sitagliptin intermediate (R)-3-amino-1 -Piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.

[0061]

[0062] The final concentration composition of the catalytic system (100ml) and the catalytic conditions are as follows: 0.75g of wet bacteria, pH 8-8.5 triethanolamine buffer, substrate sitagliptin precursor ketone 50g / L, final DMSO concentration of 20% (v / v), pyridoxal phosphate 2mmol / L, isopropylamine 80g / L.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an omega-transaminase mutant and application thereof in preparation of sitagliptin intermediate. The omega-transaminase mutant is obtained by performing single mutation on the56 position or the 134 position of an amino acid sequence as shown in a SEQ ID No.2; the 56 phenylalanine is substituted by valine, histidine or tyrosine; and the 134 threonine is substituted by glycine. The omega-transaminase mutant has relatively high enzyme activity which is higher than 300U / g and is at least 2.7 times that of a wild type since the omega-transaminase mutant is subjected to site-specific mutagenesis by acquiring certain sites possibly influencing the catalytic activity of the omega-transaminase mutant through molecular docking, homologous modeling and other modes, can be used for efficiently catalyzing precursor ketone 1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone of the sitagliptin intermediate to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone, and has a conversion rate of 85 percent.

Description

Technical field [0001] The present invention relates to the technical field of biochemical industry, in particular to an ω-transaminase mutant and its application in the preparation of sitagliptin intermediates, in particular to the preparation of sitagliptin intermediate 1-piperidine-4-( 2,4,5-trifluorophenyl)-1,3-dibutyl ketone. Background technique [0002] Sitagliptin was developed and developed by Merck and Codexis. It is the first dipeptidyl peptidase-4 (DPP-4) inhibitor approved by the FDA for the treatment of type 2 diabetes (October 2016) ), which is also the active ingredient of Genovie (Sitagliptin Hydrochloride Tablets, JANUVIA), an oral treatment for type II diabetes. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor. It inhibits its activity by binding the amide moiety to the active part of DPP-4, prolongs the half-life of Incretin, and makes GLP in plasma -1 and GIP activity increases while only slightly increasing their content, but it will not cause sid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P17/12C12R1/19
CPCC12N9/1096C12N15/70C12P17/12C12Y206/01
Inventor柳志强程峰陈秀玲张晓健郑裕国何人宝金逸中林娇华
OwnerZHEJIANG UNIV OF TECH