Supercharge Your Innovation With Domain-Expert AI Agents!

Beta-glucosidases, coding gene thereof, and expression and application of beta-glucosidases

A glucosidase and gene technology, applied in the field of genetic engineering technology and biomedicine, can solve the problems of complex parent nucleus structure of natural products, inability to apply large-scale production, difficult chemical synthesis, etc., and achieve excellent thermal stability and strong transformation ability. , the effect of strong glucose tolerance

Pending Publication Date: 2020-09-22
INST OF CHEM IND OF FOREST PROD CHINESE ACAD OF FORESTRY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The content of aglycone and monoglycoside flavonoids and saponins in plant extracts is significantly lower than that of highly glycosylated derivatives, and some components are rare components, so the recovery rate of direct extraction is low and cannot be applied on a large scale production; in addition, flavonoids and saponins natural products have a complex core structure, which makes chemical synthesis more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-glucosidases, coding gene thereof, and expression and application of beta-glucosidases
  • Beta-glucosidases, coding gene thereof, and expression and application of beta-glucosidases
  • Beta-glucosidases, coding gene thereof, and expression and application of beta-glucosidases

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0066] The preparation method of β-glucosidase described in the present invention refers to the separation and purification of induced expression, inducing and culturing the expression host bacteria containing the recombinant plasmid at 37°C without adding IPTG, collecting the bacteria by ultrasonic crushing, and taking the supernatant for affinity chromatography get the fusion protein.

[0067] The present invention also provides a method for converting glycoside natural compounds to prepare highly active aglycone or monoglycoside derivatives, specifically, the β-glucosidase of the present invention can enzymatically decompose isoquercetin at pH 6.5 and 95°C High value-added components such as quercetin, ginsenoside Rd, icariin II and icariin were prepared from ginsenoside Rb1, ginsenoside Rb2, icariin and icariin I.

Embodiment 1

[0069] Example 1: Construction of recombinant plasmid pET-IAGBGL1

[0070] After codon optimization Ignisphaera aggregans DSM 17230 high temperature resistant β-glucosidase gene design primers, the primers were synthesized by Shanghai Bioengineering Co., Ltd. The primer sequences are as follows:

[0071] Upstream primer P1: CC CATATG GGCTTAAAATATCCGAAAGAA (SEQ ID NO. 3), underlined Nde I site.

[0072] Downstream primer P2: CCC CTCGAG AATCAGAATCTGCGGCTGGG (SEQ ID NO. 4), the XhoI site is underlined, and the stop codon is removed.

[0073] Carry out PCR amplification, the amplification condition is 95°C, 5 min; pause the timer, add Pyrobest polymerase, add 40 μL paraffin oil to seal; 30 cycles (94°C, 30 s; 58°C, 30 s; 72°C, 1.5 min); 72°C, 10 min; stop the reaction, keep warm at 4°C. PCR amplification products were purified using a gel extraction kit. The DNA molecule of β-glucosidase IAGBGL1 was obtained, the nucleotide sequence of which is shown in SEQ ID NO.2. ...

Embodiment 2

[0075] Embodiment 2: the preparation of β-glucosidase of the present invention

[0076] The recombinant plasmid pET-IAGBGL1 was transformed into Escherichia coli BL21(DE3) host bacteria (purchased from Novagen), and placed on an LB plate containing ampicillin (50 μg / mL) (LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 5g / L, agar 15 g / L) after culturing overnight at 37°C, pick the transformant into 200 mL of LB medium (50 μg / mL ampicillin) at 37°C, shake at 200 rpm until OD600 At 0.6, add a final concentration of 0.5 mM isopropyl β-D-thiogalactopyranoside (IPTG) inducer, incubate at 30°C for 6 h, and use a high-speed refrigerated centrifuge to cool the culture medium at 4°C at 13,000 Centrifuge at rpm for 15 min to collect the cells.

[0077] Since the recombinant plasmid pET-IAGBGL1 contains a His-tag tag, it was purified by His•Bind Purification Kit (purchased from Novagen) to obtain a purified recombinant enzyme. The specific operation process:

[0078] A. Processin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to beta-glucosidases, a coding gene thereof, and expression and application of the beta-glucosidases, and belongs to the field of genetic engineering techniques and biopharmaceuticals. The amino acid sequence of the beta-glucosidases is shown as SEQID NO.1, and the sequence of the coding gene is shown as SEQID NO.2. The conversion condition of the beta-glucosidases includes that the pH is 4-8 and the temperature is 30-95 DEG C, and the optimal conversion condition includes that the pH is 6.5, and the temperature is 95 DEG C. The high temperature resistant beta-glucosidases can bear high temperature for a long time, are excellent in heat stability, have high sugar bearing capacity and are difficult to inhibit by products; the beta-glucosidases have the capacity for hydrolyzing various glucoside, after the beta-glucosidases and natural compounds of isoquercitin, icariin, icariside II, ginsenoside Rb1, ginsenoside Rb2 and the like are incubated under suitable condition, complete conversion can be realized nearly, and quercetin, icariside II, icaritin and ginsenoside Rd, higher in activity, can be obtained.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and biomedicine, and specifically relates to a beta-glucosidase, its coding gene, its expression and application. Background technique [0002] Natural medicines derived from plants, such as flavonoids and saponins, are often linked with different types and numbers of sugar groups, and exist in the leaves, stems and roots of plants in the form of glycosides. With the advancement of modern separation and analysis techniques, active substances in various plant materials have been isolated and identified, and their activities have also been deeply analyzed. Depending on the type, quantity and connection position of glycosides, the activities of these natural medicines also have significant differences, especially in antitumor, anti-inflammatory and neuroprotective activities. [0003] Studies have shown that poplar bark is rich in flavonoid glycosides such as rutin, and its deglycosyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/70C12N1/21C12P33/20C12R1/19
CPCC12N9/2445C12Y302/01021C12N15/70C12P33/20
Inventor 解静聪蒋剑春张宁杨静徐浩赵剑
Owner INST OF CHEM IND OF FOREST PROD CHINESE ACAD OF FORESTRY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More