Beta-glucosidases, coding gene thereof, and expression and application of beta-glucosidases
A glucosidase and gene technology, applied in the field of genetic engineering technology and biomedicine, can solve the problems of complex parent nucleus structure of natural products, inability to apply large-scale production, difficult chemical synthesis, etc., and achieve excellent thermal stability and strong transformation ability. , the effect of strong glucose tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0066] The preparation method of β-glucosidase described in the present invention refers to the separation and purification of induced expression, inducing and culturing the expression host bacteria containing the recombinant plasmid at 37°C without adding IPTG, collecting the bacteria by ultrasonic crushing, and taking the supernatant for affinity chromatography get the fusion protein.
[0067] The present invention also provides a method for converting glycoside natural compounds to prepare highly active aglycone or monoglycoside derivatives, specifically, the β-glucosidase of the present invention can enzymatically decompose isoquercetin at pH 6.5 and 95°C High value-added components such as quercetin, ginsenoside Rd, icariin II and icariin were prepared from ginsenoside Rb1, ginsenoside Rb2, icariin and icariin I.
Embodiment 1
[0069] Example 1: Construction of recombinant plasmid pET-IAGBGL1
[0070] After codon optimization Ignisphaera aggregans DSM 17230 high temperature resistant β-glucosidase gene design primers, the primers were synthesized by Shanghai Bioengineering Co., Ltd. The primer sequences are as follows:
[0071] Upstream primer P1: CC CATATG GGCTTAAAATATCCGAAAGAA (SEQ ID NO. 3), underlined Nde I site.
[0072] Downstream primer P2: CCC CTCGAG AATCAGAATCTGCGGCTGGG (SEQ ID NO. 4), the XhoI site is underlined, and the stop codon is removed.
[0073] Carry out PCR amplification, the amplification condition is 95°C, 5 min; pause the timer, add Pyrobest polymerase, add 40 μL paraffin oil to seal; 30 cycles (94°C, 30 s; 58°C, 30 s; 72°C, 1.5 min); 72°C, 10 min; stop the reaction, keep warm at 4°C. PCR amplification products were purified using a gel extraction kit. The DNA molecule of β-glucosidase IAGBGL1 was obtained, the nucleotide sequence of which is shown in SEQ ID NO.2. ...
Embodiment 2
[0075] Embodiment 2: the preparation of β-glucosidase of the present invention
[0076] The recombinant plasmid pET-IAGBGL1 was transformed into Escherichia coli BL21(DE3) host bacteria (purchased from Novagen), and placed on an LB plate containing ampicillin (50 μg / mL) (LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 5g / L, agar 15 g / L) after culturing overnight at 37°C, pick the transformant into 200 mL of LB medium (50 μg / mL ampicillin) at 37°C, shake at 200 rpm until OD600 At 0.6, add a final concentration of 0.5 mM isopropyl β-D-thiogalactopyranoside (IPTG) inducer, incubate at 30°C for 6 h, and use a high-speed refrigerated centrifuge to cool the culture medium at 4°C at 13,000 Centrifuge at rpm for 15 min to collect the cells.
[0077] Since the recombinant plasmid pET-IAGBGL1 contains a His-tag tag, it was purified by His•Bind Purification Kit (purchased from Novagen) to obtain a purified recombinant enzyme. The specific operation process:
[0078] A. Processin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


