Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Nicotinamide ribokinase mutant as well as coding gene and application thereof

A technology of nicotinamide riboside and ribokinase, which is applied in the field of biological enzyme engineering, can solve the problems of difficulty in realizing industrial production, unsatisfactory nicotinamide ribokinase activity, and high cost of raw materials, so as to reduce the amount of enzyme used, fermentation capacity and cost , the effect of increasing the yield

Active Publication Date: 2021-01-29
中山俊凯生物技术开发有限公司
View PDF10 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Aiming at the deficiencies in the prior art, the technical problem to be solved in the present invention is to provide a mutant of nicotinamide ribokinase and its coding gene and application, so as to solve the problem that the raw material cost of the existing NMN preparation method is high and the wild-type nicotinamide ribokinase The activity is not ideal and it is difficult to realize the problem of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The construction of embodiment one prokaryotic expression system

[0032] The NrK gene fragment was synthesized by Changzhou Jiyu Biotechnology Co., Ltd. and recombined into the PUC57 vector. After double digestion with restriction endonucleases NdeI and HindIII (purchased from New England Biolabs, NEB) at 37°C for 4 hours, they were separated by 1% agarose gel electrophoresis and recovered by gel cutting (the gel recovery kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). Subsequently, it was ligated with the expression vector pET28a(+) (Novagen Company) that had also undergone double enzyme digestion, and placed in a low-temperature ligator under the action of T4 DNA ligase (purchased from Takara Company) overnight. The connection solution was used to transform DH5a competent cells, and colony PCR screening and sequencing verification were performed to obtain the positive recombinant plasmid NrK-pET28a(+).

[0033] The positive recombinant p...

Embodiment 2

[0035] Shake flask fermentation of embodiment two enzymes prepares enzyme freeze-dried powder

[0036] The expression strain NrK-pET28a(+) / BL21(DE3) constructed above was added with a final concentration of 30 μg / mL, 5 mL LB liquid medium [10 g / L tryptone (OXIOD), 5 g / mL kanamycin sulfate L yeast powder (OXIOD), 10g / L sodium chloride (Sinopharm Reagent)], after shaking and culturing at 37°C and 200rpm overnight, inoculate it with a final concentration of 30μg / mL kana sulfate at a ratio of 1% (V / V). Mycin 400mL LB liquid medium, at 37 ℃, 200rpm shaking culture. Waiting for OD 600 Between 0.8-1.0, the inducer IPTG (isopropyl-β-D-thiogalactopyranoside) was added at a final concentration of 0.1 mM, and induced overnight at 25°C. The bacteria were collected by centrifugation at 4°C and 8000rpm, then suspended in 50mM pH7.0 sodium phosphate buffer, ultrasonically disrupted (200W, 3s / 5s, 30min), centrifuged at 4°C and 12000rpm for 20min, and the supernatant was collected for nickel...

Embodiment 3

[0037] Construction and screening of embodiment three mutants

[0038] Construction of mutants: The possible beneficial mutation sites predicted by macromolecular modeling techniques are four pairwise joint mutation combinations of S9 and L102, G7 and W112, F52 and H146, and S139 and Y142. Then use the NrK-pET28a(+) recombinant plasmid as a template and use the corresponding synthetic primers to amplify the mutated DNA fragment by PCR for the first time, then use the obtained fragment as a template by PCR, and amplify the full length of NrK for the second time to obtain the mutation Gene.

[0039] in:

[0040] 9 point mutations

[0041] Forward primer (SEQ ID NO: 7): 5'CCCATATGAAAACCTTCATCATTGGTATTTGCGG 3',

[0042] The reverse primer is T7ter universal primer (SEQ ID NO: 8): 5'TGCTAGTTATTGCTCAGCGG 3';

[0043] 102 point mutation

[0044] Forward primer (SEQ ID NO:9): 5'GAAGGTTTTCTGTGCTTCAACTACA 3',

[0045] Reverse primer (SEQ ID NO: 10): 5'TGTAGTTGAAGCACAGAAAACCTTC 3';...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological enzyme engineering and particularly relates to a nicotinamide ribokinase mutant as well as an encoding gene and application thereof. Comparedwith wild nicotinamide ribokinase with the amino acid sequence shown as SEQ ID NO: 2, the amino acid sequence of the nicotinamide ribokinase mutant is subjected to single mutation, pairwise joint mutation, three joint mutations or any one of four joint mutations at the 9th site, the 102nd site, the 52nd site and the 146th site of the amino acid sequence shown as SEQ ID NO: 2. The nicotinamide ribokinase mutant provided by the invention can be used for synthesizing and preparing beta nicotinamide mononucleotide. Compared with a wild type enzyme, the nicotinamide ribokinase mutant constructed by the invention has the advantages that the enzyme activity is improved by 3.86-4.53 times, the reaction time is shortened, the use amount of the enzyme can be remarkably reduced, the fermentation capacity and the cost are reduced, the NMN yield is improved, and the nicotinamide ribokinase mutant has a wide prospect of large-scale industrial application.

Description

technical field [0001] The invention relates to the technical field of biological enzyme engineering, in particular to a nicotinamide ribokinase mutant, its coding gene and its application. Background technique [0002] Nicotinamide mononucleotide (NMN) is a naturally occurring biologically active nucleotide. NMN has two irregular forms, the α isomer and the β isomer. Among them, the β isomer is the active form of NMN with a molecular weight of 334.221 g / mol. NMN is the nicotinamide adenine dinucleotide (Nicotinamide adenine dinucleotide, NAD + , also known as coenzyme I) is an important intermediate in the synthetic pathway. In recent years, relevant research reports in international authoritative academic journals such as Science, Nature, and Cell have shown that supplementing NMN can effectively increase and restore the level of coenzyme I in the body, greatly delay aging and prevent various neuron degenerative diseases such as Alzheimer's disease, and Thus fundamental...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/70C12N15/75C12N15/76C12N15/81C12N1/21C12N1/19C12P19/30C12R1/19C12R1/125C12R1/465C12R1/84
CPCC12N9/1205C12N15/70C12N15/75C12N15/76C12N15/815C12P19/30C12Y207/01022
Inventor 周嘉莹戴维余允东徐广见刘慧
Owner 中山俊凯生物技术开发有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com