Nicotinamide ribokinase mutant as well as coding gene and application thereof
A technology of nicotinamide riboside and ribokinase, which is applied in the field of biological enzyme engineering, can solve the problems of difficulty in realizing industrial production, unsatisfactory nicotinamide ribokinase activity, and high cost of raw materials, so as to reduce the amount of enzyme used, fermentation capacity and cost , the effect of increasing the yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0031] The construction of embodiment one prokaryotic expression system
[0032] The NrK gene fragment was synthesized by Changzhou Jiyu Biotechnology Co., Ltd. and recombined into the PUC57 vector. After double digestion with restriction endonucleases NdeI and HindIII (purchased from New England Biolabs, NEB) at 37°C for 4 hours, they were separated by 1% agarose gel electrophoresis and recovered by gel cutting (the gel recovery kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). Subsequently, it was ligated with the expression vector pET28a(+) (Novagen Company) that had also undergone double enzyme digestion, and placed in a low-temperature ligator under the action of T4 DNA ligase (purchased from Takara Company) overnight. The connection solution was used to transform DH5a competent cells, and colony PCR screening and sequencing verification were performed to obtain the positive recombinant plasmid NrK-pET28a(+).
[0033] The positive recombinant p...
Embodiment 2
[0035] Shake flask fermentation of embodiment two enzymes prepares enzyme freeze-dried powder
[0036] The expression strain NrK-pET28a(+) / BL21(DE3) constructed above was added with a final concentration of 30 μg / mL, 5 mL LB liquid medium [10 g / L tryptone (OXIOD), 5 g / mL kanamycin sulfate L yeast powder (OXIOD), 10g / L sodium chloride (Sinopharm Reagent)], after shaking and culturing at 37°C and 200rpm overnight, inoculate it with a final concentration of 30μg / mL kana sulfate at a ratio of 1% (V / V). Mycin 400mL LB liquid medium, at 37 ℃, 200rpm shaking culture. Waiting for OD 600 Between 0.8-1.0, the inducer IPTG (isopropyl-β-D-thiogalactopyranoside) was added at a final concentration of 0.1 mM, and induced overnight at 25°C. The bacteria were collected by centrifugation at 4°C and 8000rpm, then suspended in 50mM pH7.0 sodium phosphate buffer, ultrasonically disrupted (200W, 3s / 5s, 30min), centrifuged at 4°C and 12000rpm for 20min, and the supernatant was collected for nickel...
Embodiment 3
[0037] Construction and screening of embodiment three mutants
[0038] Construction of mutants: The possible beneficial mutation sites predicted by macromolecular modeling techniques are four pairwise joint mutation combinations of S9 and L102, G7 and W112, F52 and H146, and S139 and Y142. Then use the NrK-pET28a(+) recombinant plasmid as a template and use the corresponding synthetic primers to amplify the mutated DNA fragment by PCR for the first time, then use the obtained fragment as a template by PCR, and amplify the full length of NrK for the second time to obtain the mutation Gene.
[0039] in:
[0040] 9 point mutations
[0041] Forward primer (SEQ ID NO: 7): 5'CCCATATGAAAACCTTCATCATTGGTATTTGCGG 3',
[0042] The reverse primer is T7ter universal primer (SEQ ID NO: 8): 5'TGCTAGTTATTGCTCAGCGG 3';
[0043] 102 point mutation
[0044] Forward primer (SEQ ID NO:9): 5'GAAGGTTTTCTGTGCTTCAACTACA 3',
[0045] Reverse primer (SEQ ID NO: 10): 5'TGTAGTTGAAGCACAGAAAACCTTC 3';...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 