7beta-HSDH enzyme mutant as well as coding gene and application thereof

A technology for encoding genes and mutants, which is applied to 7β-HSDH enzyme mutants and their encoding genes and application fields, can solve the problems of unsatisfactory hydroxysteroid dehydrogenase activity and difficulty in realizing industrialized production, etc., and achieves broad industrial application prospects, The effect of reducing the amount of enzyme used and reducing the reaction time

Active Publication Date: 2021-12-24
ZHONGSHAN BAILING BIOTECHNOLOGY CO LTD
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In view of the deficiencies in the prior art, the technical problem to be solved in the present invention is to provide a 7β-HSDH enzyme mutant and its coding gene and application, so as to solve the problem that the existing hydroxysteroid dehydrogenase activity is not ideal and it is difficult to realize industrial production. question

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 7beta-HSDH enzyme mutant as well as coding gene and application thereof
  • 7beta-HSDH enzyme mutant as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] The construction of embodiment one prokaryotic expression system

[0063] The 7β-HSDH gene fragment was synthesized by Changzhou Jiyu Biotechnology Co., Ltd., and recombined into the PUC57 vector. After double digestion with restriction endonucleases NdeI and HindIII (purchased from New England Biolabs, NEB) at 37°C for 4 hours, they were separated by 1% agarose gel electrophoresis and recovered by gel cutting (the gel recovery kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). Subsequently, it was ligated with the expression vector pET21a(+) (Novagen Company) that had also undergone double enzyme digestion, and placed in a low-temperature ligator under the action of T4 DNA ligase (purchased from Takara Company) overnight. The connection solution was used to transform DH5a competent cells (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), and colony PCR screening and sequencing verification were performed to obtain the positiv...

Embodiment 2

[0066] Shake flask fermentation of embodiment two enzymes prepares enzyme freeze-dried powder

[0067] The expression strain 7β-HSDH-pET21a(+) / BL21(DE3) constructed above was added to 5mL LB liquid medium [10g / L tryptone (OXIOD), 5g / L yeast powder (OXIOD), 10g / L sodium chloride (Sinopharm Reagent)】, shake culture overnight at 37°C and 200rpm, inoculate 400mL LB with a final concentration of 100μg / mL ampicillin at a ratio of 1% (V / V) In the liquid culture medium, shake culture at 37°C and 200rpm. Waiting for OD 600 When between 0.8-1.0, the inducer IPTG (isopropyl-β-D-thiogalactopyranoside, IPTG) was added at a final concentration of 0.1 mM, and induced overnight at 30°C. The bacteria were collected by centrifugation at 4°C and 8000rpm, then suspended in 50mM pH7.0 sodium phosphate buffer, ultrasonically disrupted (200W, 3s / 5s, 20min), centrifuged at 4°C and 12000rpm for 20min, and the supernatant was taken for freezing After drying, the enzyme freeze-dried powder is obtaine...

Embodiment 3

[0068] Construction and screening of embodiment three mutants

[0069] Construction of mutants: The possible beneficial mutation sites were predicted by macromolecular modeling technology as N237 and S240, and site-directed mutations were performed on these two sites (N237K, N237H, N237Q, S240N, S240R, S240E , S240Q). Then use the 7β-HSDH-pET28a(+) recombinant plasmid as a template and use the corresponding synthetic primers to amplify the mutant DNA fragment in the first PCR, and then use the obtained fragment as a template in PCR to amplify the full length of 7β in the second PCR - Mutated gene of HSDH. (For the specific mutation operation, refer to Stratagene’s Site-Directed Mutagenesis Kit Operation Instructions).

[0070] in:

[0071] N237K site mutation (asparagine at position 237 is mutated to lysine)

[0072] Forward primer (SEQ ID NO: 33): 5' TCGCCGGTCAACGTAAAAAAGATAGCGTCC 3',

[0073] Reverse primer (SEQ ID NO: 34): 5'GGACGCTATCTTTTTTACGTTGACCGGCGA 3';

[007...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 7beta-HSDH enzyme mutant as well as a coding gene and application thereof. Compared with a wild type 7beta-HSDH enzyme with an amino acid sequence shown as SEQ ID NO: 2, the amino acid sequence of the 7beta-HSDH enzyme mutant has the advantage that any one of single mutation or pairwise combined mutation is carried out on the 237th site and the 240th site of the amino acid sequence shown as SEQ ID NO: 2. The 7beta-HSDH enzyme mutant can be used for synthesis and preparation of 24-nor ursodeoxycholic acid, the 7beta-HSDH enzyme mutant is used as a biocatalyst to convert a substrate 24-nor-7-ketocholic acid to generate 24-nor ursodeoxycholic acid, and HPLC verifies that the reaction conversion rate is greater than 90%. Compared with a wild enzyme, the 7beta-HSDH enzyme mutant constructed by the invention has the advantages that the catalytic activity is obviously improved, the use amount of the enzyme can be obviously reduced, and the 7beta-HSDH enzyme mutant has a wide prospect of large-scale industrial application.

Description

technical field [0001] The invention relates to the technical field of biological enzyme engineering, in particular to a 7β-HSDH enzyme mutant and its coding gene and application. Background technique [0002] 24-Demethylursodeoxycholic acid (norUDCA for short), which is a homologue of ursodeoxycholic acid, has one less methylene group than the side chain of ursodeoxycholic acid, and has liver protection, anti-inflammatory and anti-fibrosis activities , can improve serum alkaline phosphatase levels and other cholestatic conditions in patients with primary sclerosing cholangitis. A recent phase IIa randomized double-blind controlled study reported that high-dose 24-desmethylursodeoxycholic acid (norUDCA) can significantly improve serum transaminases, triglycerides and liver imaging in patients with nonalcoholic fatty liver disease (NAFLD) The clinical indicators, and the drug safety is good [Yang Ruixu, Fan Jiangao. AASLD2017: 24-norursodeoxycholic acid in the treatment of n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12N1/21C12N15/70C12N15/75C12N15/76C12N15/81C12P33/06C12R1/19C12R1/84C12R1/465C12R1/125
CPCC12N9/0006C12Y101/01201C12N15/70C12N15/75C12N15/76C12N15/815C12P33/06Y02A50/30
Inventor余允东张和平容文西杨卓星
OwnerZHONGSHAN BAILING BIOTECHNOLOGY CO LTD