VZV infection diagnosis and detection kit based on chemiluminescence immunoassay

A chemiluminescence immunization and detection kit technology, applied in the fields of medicine and clinical biology, can solve the problems affecting the effectiveness of PCR results, such as vaccines, and achieve the effect of reducing false negatives and false positives

Pending Publication Date: 2022-03-08
UNIV OF SCI & TECH OF CHINA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although molecular diagnostics (including DNA virus isolation from vesicular fluid cultures and swab samples) and nucleic acid detection (PCR) are the most sensitive in VZV diagnosis, antibody assessment is still required during VZV epidemiological surveillance (since the vesicular rash does not appear at any point in the infection and may affect PCR results) and effectiveness of vaccination control
Also, the primary diagnostic method based on clinical presentation is not 100% reliable, as there are many other herpetic diseases, including HSV, that present with similar symptoms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • VZV infection diagnosis and detection kit based on chemiluminescence immunoassay
  • VZV infection diagnosis and detection kit based on chemiluminescence immunoassay
  • VZV infection diagnosis and detection kit based on chemiluminescence immunoassay

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 sample selection and processing

[0037] 1. Sample selection

[0038] For the purposes of the present invention, two types of samples are required, including experimental group samples and control samples. Samples in the experimental group refer to samples from patients suspected of being infected with VZV, preferably patients with obvious symptoms of VZV infection, more preferably samples from patients with confirmed positive diagnostic results based on ELISA or PCR analysis. Control samples refer to samples from patients not infected with VZV, preferably healthy people who have not been vaccinated against any VZV vaccine. Sampling requires the consent of each patient and should be conducted according to ethical practice.

[0039] 2. Sample Processing

[0040] The present invention is performed using human clinical samples, preferably human blood samples, and has been approved by an ethics committee. Blood samples were obtained from forearm punctures of p...

Embodiment 2

[0041] Example 2 The construction of the baculovirus expression system expressing recombinant His-SUMOstar-VZV-gE protein

[0042] 1. Construction of a recombinant transformation vector carrying the VZV-gE sequence

[0043] To achieve the purpose of the present invention, obtain the gene sequence of the mature extracellular region of VZV-gE encoding VZV, use the following forward and reverse primers to obtain the VZV-gE extracellular structure of accession number MH709377.1 (SEQ ID NO:1) Domains; 5'-ATTTCCAAGGTTCTTCCGTCTTGCGATACGATGATTTTCACATC-3' (SEQ ID NO: 2) and 5'-GACAAGCTTGGTACTTAATATCGTAGAAGTGGTGACGTTCCGGG-3' (SEQ ID NO: 3). Meanwhile, the histidine tag-modified transformation vector pI-SUMOsec-Star-His was linearized by the following primers (forward: 5'CTTCTACGATATTAAGTACCAAGCTTGTCGAGAAGTACTAGAGG3' (SEQ ID NO: 4) and reverse: 5' TATCGCAAGACGGAAGAACCTTGGAAATAAAGATTCTCGCTGCC3' (SEQ ID NO: 5)), the primers comprise sequences overlapping the 5' and 3' end sequences of VZV...

Embodiment 3

[0048] Expression and purification of embodiment 3VZV-gE protein

[0049] 1. Expression of recombinant His-SUMOstar-VZV-gE protein

[0050] When in optimal expression conditions, infect 2×10 6 Spodoptera frugiperda (Trichoplusia ni) (High Five, Hi5) cells and incubated at 27°C in a spin shaker. The medium does not contain serum, only penicillin and streptomycin (PS) as antibiotics. After about 3 to 4 days, the cell culture was stopped, and the expressed recombinant protein was collected by centrifuging the culture (30 minutes at high speed) (rotating speed: 5000 g), so as to perform subsequent protein purification.

[0051] 2. Purification of recombinant VZV-gE protein

[0052] The purification steps of the recombinant VZV-gE protein include membrane filtration, dialysis, first nickel column purification, TEV protease digestion combined with dialysis, second nickel column purification, gel filtration chromatography and ultracentrifugal concentration.

[0053] a. Membrane f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a VZV infection diagnosis and detection kit based on a chemiluminescence immunoassay method. According to the present invention, with the automated chemiluminescence immunoassay technology, the specific varicella-zoster virus antibodies such as immunoglobulin isoforms G, A and M (IgG, IgA and IgM) can be detected so as to diagnose diseases related to varicella-zoster virus infection. The kit provided by the invention is also suitable for screening various subjects suspected of diseases or symptoms related to VZV infection.

Description

technical field [0001] The invention belongs to the field of medicine and clinical biotechnology, in particular to diagnostic devices and methods, and in particular to chemiluminescent immunoassay techniques and methods for easily detecting and / or monitoring the presence of varicella-zoster virus-specific immunoglobulins IgG, IgA and IgM Kits and methods. Background technique [0002] Varicella-zoster virus (VZV), known as human herpesvirus-3 (HHV-3), and herpes simplex virus (HSV) both belong to the subfamily Alpha-Herpesviridae. VZV is a double-stranded DNA (125 kb) virus consisting of an icosahedral capsid with a diameter of 120 nm surrounded by a lipid envelope. The virus that causes varicella disease, or varicella, in children, adolescents, and young adults remains latent in the body after it has been cured. Until adulthood or old age, the latent virus can recur causing shingles. Chickenpox is less common in adults but is common in pregnant women and immunocompromise...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/866C12N15/38C07K14/04C07K1/36C07K1/34C07K1/22C07K1/14G01N33/569G01N33/68G01N21/76
CPCC12N15/86C07K14/005G01N33/56994G01N33/6854G01N21/76C12N2710/14143C12N2710/16722C12N2710/16751G01N2333/04G01N2469/20
Inventor 金腾川阿诺德·约翰·康贝·康贝
Owner UNIV OF SCI & TECH OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap