Pichia pastoris genetically engineered bacterium for heterologous expression of recombinant catalase and application of pichia pastoris genetically engineered bacterium

A technology of catalase and genetically engineered bacteria, applied in the direction of genetic engineering, oxidoreductase, application, etc., can solve the problems of reduced stability, complicated production process, and reduced target protein output, so as to reduce production and use costs , The separation and purification process is simple, and the effect of promoting large-scale preparation

Pending Publication Date: 2022-03-11
李宪臻
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of Escherichia coli to express catalase has solved the problem of long production cycle of catalase to a certain extent, but the application of Escherichia coli in the food industry has potential safety hazards, and the peroxidase produced by the E. coli expression system Hydrogenase is mainly expressed in cells, and subsequent isolation requires steps such as bacterial liquid separation, cell disruption, and target protein separation and purification.
This method has higher requirements on the production process conditions and the production process becomes more complicated. The initial investment is large and the amount of subsequent three wastes is also very large. In addition, the application of E. coli in the food industry has potential safety hazards.
Using Bacillus subtilis to express catalase can achieve extracellular secretion and expression, thus simplifying the process flow, but this expression system will produce a large amount of extracellular foreign protein during the process of expressing the target protein, which not only makes the subsequent separation and purification steps of the target protein The increase increases the cost of separation, and the extracellular protein contains a large number of proteases that can degrade the target protein, thereby reducing the yield of the target protein and reducing its stability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia pastoris genetically engineered bacterium for heterologous expression of recombinant catalase and application of pichia pastoris genetically engineered bacterium
  • Pichia pastoris genetically engineered bacterium for heterologous expression of recombinant catalase and application of pichia pastoris genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction of pPICZαA-KatA expression vector

[0041] Synthesize the following primers respectively:

[0042] Primer pPICZαA-KatA-F:

[0043] SEQ ID NO.2:

[0044] 5'-AGGGGTATCTCTCGAGAAAAGAAGTTCAAATAAACTGACAACTAGCTGG-3'

[0045] Primer pPICZαA-KatA-R:

[0046] SEQ ID NO.3:

[0047] 5’-TCAATGATGATGATGATGATGAGAATCTTTTTTAATCGGCAATCCAAGGCCTTCT GCCAC-3’

[0048] Using RF cloning technology, under the guidance of the above primers, the plasmid pMD 19-T-KatA (nucleotide sequence shown in SEQ ID NO.1) preserved in the laboratory was used as a template to carry out the second One round of PCR amplification obtained the KatA gene containing the homology arm of the pPICZαA vector. The obtained PCR products were separated by 1% agarose gel electrophoresis, and purified and recovered by using a DNA gel recovery kit. Then, the long fragment obtained from the first round of PCR reaction was used as a primer, and the plasmid pPICZαA was used as a template to amplify ...

Embodiment 2

[0049] 6. Example 2 Heterologous expression of recombinant catalase

[0050] The recombinant expression plasmid pPICZαA-KatA obtained in Example 1 was linearized with the restriction endonuclease Sac I, and after electrophoresis was verified to be correct, the recovered linearized recombinant plasmid was transformed into Pichia pastoris X by electroporation -33 competent cells were spread on YPD solid plate containing 100 μg / ml zeocin antibiotic and cultured at 30°C for 3-4 days. Pick a single colony with a smooth surface and a good shape from the plate and place it in 10 ml YPD liquid medium containing 30 μg / ml zeocin at 200 rpm at 30°C for 24 hours to obtain a seed solution. Then take 1ml of the above seed solution and put it into 100ml of BMGY medium, culture at 200rpm, 30°C for 16-18h. Centrifuge 5000 g of the bacterial solution obtained from BMGY medium at 4°C for 20 minutes, discard the supernatant, resuspend in 200 mL of BMMY medium, and cultivate at 200 rpm at 30°C. ...

Embodiment 3

[0051] Embodiment 3 Separation and purification of recombinant catalase

[0052] The fermented bacterial liquid was centrifuged at 10,000 g at 4°C for 20 min, and the extracellular supernatant was collected and concentrated by ultrafiltration and buffer exchange, so that the protein was finally stored in 50 mM phosphate buffer at pH 7.0. Subsequently, the above protein samples were subjected to DEAE anion exchange chromatography, and linear gradient elution was carried out through an elution buffer containing NaCl, and the eluted samples were detected by SDS-PAGE electrophoresis, and the results were as follows figure 1 As shown, lane M is the protein molecular weight standard, and lane 1 is the eluted sample. A single band appears between 44.3-66.4kDa, which is consistent with the expected relative molecular mass of the target protein of 55.5kDa, indicating that the recombinant catalase has been successfully purified .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses pichia pastoris genetically engineered bacteria for heterologous expression of recombinant catalase and application, and belongs to the technical field of industrial biology. The invention relates to a pichia pastoris genetically engineered bacterium for heterologous expression of recombinant catalase. The pichia pastoris genetically engineered bacterium carries a recombinant expression vector of an alkali-resistant catalase gene which is derived from Bacillus subtilis 168 and is shown as SEQ ID NO. 1. Compared with catalase extracted from animal livers or obtained by using a prokaryotic expression system, the recombinant catalase obtained by using pichia pastoris heterologous secretory expression has the advantages that the separation and purification process is simple and convenient, and pure enzyme is easier to obtain, so that the production process of the enzyme is simplified, and the production and use cost is reduced; and a novel method is provided for scientific research and production practice requiring recombination of pure catalase.

Description

technical field [0001] The invention relates to a Pichia pastoris genetically engineered bacterium expressing recombinant catalase heterologously, and the application of the recombinant catalase produced by the genetically engineered bacterium in the fields of food, medical treatment, papermaking and textile, environmental protection, agriculture, etc., belonging to field of industrial biotechnology. Background technique [0002] Catalase is a key enzyme that widely exists in animal, plant and microbial cells and can efficiently remove excess hydrogen peroxide, thereby protecting cells from oxidative damage. In addition, because catalase can efficiently catalyze the decomposition of hydrogen peroxide into water and oxygen, it has been widely used in different industrial fields such as food, medical treatment, paper making and textile, environmental protection, agriculture: (1) in food In the field, the use of catalase in the decomposition of H 2 o 2 will rapidly generate ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N9/08C12N15/81C12N1/19C12R1/84
CPCC12N9/0065C12N15/815C12Y111/01006C12N2800/102
Inventor王从纲姜梦彤庞焦孙佳明李明玉李宪臻
Owner李宪臻