Method for improving canker resistance of citrus by utilizing CsNCED3 gene silencing

A technology of gene silencing and canker disease, applied in the field of molecular biology, can solve the problems of nucellus embryo interference, complex genetic background, low efficiency of citrus hybrid breeding, etc., and achieve the effect of improving resistance

Pending Publication Date: 2022-04-26
SOUTHWEST UNIVERSITY
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Citrus is an asexually propagated plant with complex genetic background and nucellus embryo interference, and the efficiency of citrus hybrid breeding is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving canker resistance of citrus by utilizing CsNCED3 gene silencing
  • Method for improving canker resistance of citrus by utilizing CsNCED3 gene silencing
  • Method for improving canker resistance of citrus by utilizing CsNCED3 gene silencing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Cloning of CsNCED3 gene fragment

[0039] 1. RNA extraction and cDNA synthesis

[0040] Select 0.1 g of citrus (Wanjincheng) leaves and use the EASYspin Plant RNA Rapid Extraction Kit (Adelaide, CAT: RN09) to extract total RNA from the leaves, verify the quality of RNA by non-denaturing agarose gel electrophoresis, and measure its concentration with a densitometer . cDNA was synthesized using Recombinant DNase I (Bao Biology), and the cDNA was stored at -20°C for future use.

[0041] 2. PCR amplification of CsNCED3 gene fragment

[0042] Using primers RNAi-CsNCED3-F and RNAi-CsNCED3-R to amplify the CsNCED3 fragment from citrus cDNA, the fragment length is 387bp;

[0043] Its nucleotide sequence is as follows, SEQ ID NO.3:

[0044] AATTTTGTGGTGATCCCGGACCAACAAGTCGTTTTCAAGCTCCAAGAAATGATAAC GGGTGGCTCTCCGGTGATTTATGACAAGAACAAGAAGTCCCGGTTCGGGATTCTTGCAA AGAATGCTAAAGATTCTAACGACATCATCTGGATTGAATCACCGGACACGTTCTGCTTTC ACTTGTGGAACGCTTGGGAGGAGCCGGAAACTGATGAAATTGTTGTCATTGGATCATGC ...

Embodiment 2

[0055] Construct CsNCED3 interference expression vector and transform into Agrobacterium

[0056] The vector construction flow chart is as follows figure 1 , among them, GUS::NPTⅡ: fusion gene of β-glucosidase and neomycin phosphotransferase; CaMV 35S: plant constitutive promoter derived from cauliflower mosaic virus; NOS: opine synthase gene termination The vector pLGNe has a GUS::NPTⅡ fusion gene under the control of the CaMV 35S promoter, which is convenient for kanamycin screening and GUS staining identification of transformants during plant genetic transformation; T7 promoter: the plasmid is promoted in Escherichia coli The promoter used for transcription; T7 transcription start: the starting point of T7 promoter to initiate transcription; all restriction endonucleases were purchased from (THERMO) company, and operated according to the instructions.

[0057] Wherein the nucleotide sequence of the CaMV 35S promoter is as follows, SEQ ID NO.4:

[0058] GTCCTCTCCAAATGAAATG...

Embodiment 3

[0064] Genetically Transformed Citrus (Wanjincheng)

[0065] 1. Acquisition of epicotyls from citrus seedlings

[0066] Get fresh citrus (Wan Jincheng) and wash, disinfect the surface with 70% alcohol, take out the seeds under aseptic conditions, peel off the seed coat, inoculate on the seed germination medium to germinate, and culture in dark at 28°C for 2 weeks, then Cultured for 1 week under a 16h light / 8h dark photoperiod. Under aseptic conditions, the epicotyls of germinated seedlings were taken and cut into stem segments of about 1 cm for genetic transformation of Agrobacterium tumefaciens.

[0067] 2. Preparation of Agrobacterium tumefaciens

[0068] The Agrobacterium bacteria solution (containing the CsNCED3 interference expression vector) used for transfection was stored in an ultra-low temperature incubator at -70° C. by adding 30% sterile glycerol. Before transfection, streak culture on LK solid medium containing 50mg / L kanamycin. Pick a single colony of Agrobac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving canker resistance of citrus by utilizing CsNCED3 gene silencing. The method comprises the following steps: (1) cloning a citrus CsNCED3 gene segment; (2) constructing an interference expression vector of the CsNCED3 gene segment; and (3) transforming the citrus by the interference expression vector to obtain a transgenic plant. According to the method, CsNCED3 gene silencing is utilized, citrus CsNCED3 gene segments are cloned, an interference expression vector is constructed, and then citrus is transformed, so that the expression quantity of the obtained transgenic plant CsNCED3 is remarkably reduced to 29% of that of the existing citrus, and the canker attack degree can be reduced to 47% of that of the existing citrus, and therefore, the method can improve the canker resistance of the plant to a certain extent.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a method for improving the resistance of citrus to canker by using CsNCED3 gene silencing. Background technique [0002] Citrus is the largest fruit in the world, with a total area of ​​about 142 million mu and a total output of 146 million tons. Citrus is the world's fifth most internationally traded agricultural commodity after wheat, soybeans, cotton and corn. As of the end of 2017, my country's citrus cultivation area was 39.39 million mu, with an annual output of 38.39 million tons, ranking first in the world. [0003] Citrus bacterial canker disease (Citrus bacterial canker disease) is a bacterial disease caused by Xanthomonas axonopodis pv.citri, and is one of the citrus quarantine diseases. Almost all tissues, including prickles, leaves and fruits, will cause leaf and fruit drop in severe cases, and further development will lead to dead branches and young tree...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N15/82C12N15/84A01H5/00A01H6/78
CPCC12N9/0069C12Y113/11051C12N15/8279C12N15/8218C12N15/8205
Inventor龙琴陈善春何永睿邹修平李强
OwnerSOUTHWEST UNIVERSITY