Amine dehydrogenase mutant and application thereof in preparation of (S)-5-methyl-2-pyrrolidone

An amine dehydrogenase, mutant technology, applied in the application, genetic engineering, oxidoreductase and other directions, can solve the problems of mild reaction environment, moderate stereoselectivity, low enzyme activity, etc., achieve good industrial application prospects, reduce Coenzyme dosage and high catalytic activity

Pending Publication Date: 2022-07-01
EAST CHINA UNIV OF SCI & TECH
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In 2017, Wang et al. used ammonium formate as hydrogen source and nitrogen source, and N,N-dimethylformamide as solvent, discussed the reaction of ammonium formate to directly reductively aminate levulinic acid to prepare 5-methyl-2-pyrrolidone pathway and mechanism, and optimized the reaction conditions, but its stereoselectivity is moderate (Biomass Chemical Engineering, 2017,51(02):19-25.)
The strategy is based on a selective biotransamination reaction that allows the formation of amino ester intermediates to undergo spontaneous intramolecular cyclization in their own aqueous medium without the addition of external reagents, but the first step of reductive amination requires the addition of amines. Donor, so the whole reaction has by-products and the yield is low (Advanced Synthesis & Catalysis, 2018, 360(4): 686-695)
[0009] In summary, many methods for synthesizing 5-methyl-2-pyrrolidone have been reported, which can be obtained by chemical or biocatalytic methods, but there are many disadvantages in chemical methods, such as poor diastereoselectivity and mild reaction environment , more by-products
Transaminases catalyze the reduction of aminated ketoester substrates, which require an amine donor and have low enzyme activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amine dehydrogenase mutant and application thereof in preparation of (S)-5-methyl-2-pyrrolidone
  • Amine dehydrogenase mutant and application thereof in preparation of (S)-5-methyl-2-pyrrolidone
  • Amine dehydrogenase mutant and application thereof in preparation of (S)-5-methyl-2-pyrrolidone

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Screening of TtherAmDH mutants with increased activity by random mutagenesis

[0077] TtherAmDH containing the amino acid sequence shown in SEQ ID No. 2 was randomly mutated using error-prone PCR technology.

[0078] The primers used were:

[0079] Upstream primer, as shown in SEQ ID No.3:

[0080] CCG GAATTC ATGGAAAATATAAAAGTCGTAGTTTGGGG

[0081] Downstream primer, as shown in SEQ ID No.4:

[0082] CCC AAGCTT TTAACGGCGACGAATCATAT

[0083] The sequence underlined in the upstream primer is the restriction site of EcoR I, and the sequence underlined in the downstream primer is the restriction site of Hind III.

[0084] Using pET28a-TtherAmDH as a template, error-prone PCR was performed with rTaq DNA polymerase to construct a random mutation library. PCR system (50 μL): rTaq DNA polymerase 0.5 μl, 10× PCR buffer (Mg 2+ Plus) 5.0 μl, dNTP Mixture (2.0 mM each) 4.0 μl, MnCl with a final concentration of 250 μmol / L 2 , pET28a-TtherAmDH plasmid 100ng, upstream and d...

Embodiment 2

[0087] Example 2 Semi-rational construction of TtherAmDH mutant

[0088] In Example 1, using error-prone PCR technology and high-throughput screening method, a mutation site (F24K) with significantly improved catalytic activity and soluble expression was successfully screened. Homologous modeling was performed on TtherAmDH, and then the modeled mutant model was used for molecular docking with levulinic acid. According to the catalytic mechanism and binding energy of amine dehydrogenase, an appropriate docking posture model was selected. The activity of the enzyme was further enhanced by site-directed saturation mutation and combinatorial mutation of amino acids near the substrate pocket. In the three-dimensional structure of TtherAmDH of the amino acid sequence shown in SEQ ID No.2, the amino acid residues around the levulinic acid binding site of the substrate are mainly selected from the amino acid sites on the surrounding loops. Residues were mutated by saturation.

[008...

Embodiment 3

[0109] Example 3 Recombinant E. coli BL21(DE3) / pET28a-TtherAmDH V9 expression and enzymatic preparation of

[0110] The recombinant E. coli BL21(DE3) / pET28a-TtherAmDH of the mutant V9 obtained in Example 2 was V9 Inoculated into LB medium containing 50μg / ml kanamycin, shaken at 37°C for 12h, and then inserted into 100ml LB medium (containing 50μg / ml card) at a 1% (v / v) inoculum amount. Namycin) in a 500ml Erlenmeyer flask, placed at 37°C and shaken at 220rpm for culture, when the OD600 of the culture medium reached 0.6, IPTG with a final concentration of 0.2mmol / L was added as an inducer, and induced at 16°C for 24h. The culture medium was centrifuged at 8000 × g for 10 min, the cells were collected, and washed twice with normal saline to obtain resting cells. The cells obtained in 100 ml of culture medium were suspended in 15 ml of potassium phosphate buffer (100 mM, pH 7.0), and the following ultrasonic disruption was performed in an ice-water bath: 350 W power, work for 4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an amine dehydrogenase mutant and an application of the amine dehydrogenase mutant in preparation of (S)-5-methyl-2-pyrrolidone. Specifically, the invention discloses an amine dehydrogenase mutant with improved activity, a coding gene thereof, a recombinant expression vector and a recombinant expression transformant containing the gene sequence, and application of the amine dehydrogenase mutant as a catalyst to catalysis of asymmetric reductive amination of prochiral carbonyl compounds. The invention particularly relates to an application of catalyzing asymmetric reduction of levulinic acid to prepare optically pure 5-methyl-2-pyrrolidone. Compared with the prior art, the method has the advantages of high enzymatic reaction substrate concentration, mild reaction conditions, environment friendliness, high yield, high product optical purity and the like, and has a very good application prospect.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to an amine dehydrogenase mutant with significantly improved catalytic performance, its encoding gene, a recombinant expression vector and a recombinant expression transformant containing the gene sequence, and the use of the amine dehydrogenase mutant In vivo or recombinant expression transformants catalyze latent chiral carbonyl compounds to prepare optically pure amino acids, especially the application of catalyzing asymmetric reduction of levulinic acid to prepare optically pure lactam (S)-5-methyl-2-pyrrolidone. Background technique [0002] Lactams are key compounds in organic chemistry because they are present in many biologically active products and also serve as valuable intermediates for more complex structures including synthetic polymers. Synthesis of γ-lactam (2-pyrrolidone) and δ-lactam (2-piperidone), in addition to constituting the most important c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12P17/10
CPCC12N9/0004C12P17/10
Inventor白云鹏钱源益张晓彦
OwnerEAST CHINA UNIV OF SCI & TECH