Anti-shrimp white spot syndrome virus recombined bacterium typhosum strain, preparation and uses thereof

A technology of Salmonella typhi and genetically engineered strains, which is applied in the field of anti-prawn white spot syndrome virus recombinant Salmonella typhi strain and its preparation and application, and achieves the effects of simple operation process, low cost and improved immunity

Inactive Publication Date: 2008-10-29
施成华
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far there is no relevant literature report that it is used in the study of anti-prawn white spot syndrome virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-shrimp white spot syndrome virus recombined bacterium typhosum strain, preparation and uses thereof
  • Anti-shrimp white spot syndrome virus recombined bacterium typhosum strain, preparation and uses thereof
  • Anti-shrimp white spot syndrome virus recombined bacterium typhosum strain, preparation and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Preparation of VP28 gene.

[0040] Take gills, stomach, liver and other viscera of diseased shrimp on ice, add 10 times the volume (W / V) of TN buffer solution (20mmol / L Tris-HCl; 0.4mol / L NaCl, pH7.4) to the homogenizer Homogenize in an ice bath. Centrifuge at 8000r / min for 5min, take the supernatant, add proteinase K (100μg / mL), DS buffer (50mmol / L KCl; 10mmol / L Tris-HCl, pH8.3; gelatin 0.1mg / mL; NP-40, 0.45%), boiled in boiling water at 100°C for 10-15min, immediately bathed in ice for 5min, centrifuged at 12000rpm at high speed, and took the supernatant as template DNA. Design specific primers (VP28 upstream primers, GC TCTAGA ATGGATCTTTCTTTCACTCT (the Xba I site is underlined); VP28 downstream primer, CT AAGCTT CTCGGTCTCAGTGCCAGA (the underline is the HindIII site)), amplified by PCR to obtain the sequence of the VP28 gene. PCR reaction system: 10×reaction buffer 5uL, 25mM MgCl 2 3uL (1.5mM), dNTP 1uL (0.2mM), upstream and downstream primers 1uL (...

Embodiment 2

[0041] Example 2: Preparation of CD gene.

[0042] Take 5-10 silkworms induced by Escherichia coli JM109 for 24 hours, wash them with DEPC water (0.1% diethyl pyrocarbonate aqueous solution), cut the abdominal cavity, squeeze out the fat body, and grind in liquid nitrogen In powder form, follow RNeasy R The operating instructions of the Kit were used to extract total RNA from fat body. According to the instructions of the Reverse Transcription System kit, with Oligo(dT) 20 Because of the synthesis of cDNA first strand. The reaction system is as follows: 20mM MgCl 2 12 uL, ReverseTranscription 10×Buffer 6uL, dNTP Mixture 10mM 6uL, Recombinant RNasin Rionuclease Inhibitor 2uL, CMV Reverse Transcriptase 4uL, Oligo(dT) 20 Primer 6uL, total RNA 15uL, Nuclease-free H 2 O 9uL. The reaction conditions are: 42°C for 1h, 95°C for 5min, and 4°C for 5min. The product after the reaction was used as the template of target gene cloning, and primers were designed according to the seq...

Embodiment 3

[0043] Example 3: Obtaining of VP28-CD fusion gene.

[0044]HindIII and PstI (restriction endonucleases were purchased from TAKALA company) were respectively double digested with the constructed plasmids pGEM-T-VP28 and pGEM-T-CD, and the digested products were subjected to agarose gel electrophoresis to recover pGEM- The large fragment (about 3600bp) after digestion with T-VP28 and the small fragment (about 130bp) after digestion with pGEM-T-CD.

[0045] Then, the large fragment digested by pGEM-T-VP28 and the small fragment digested by pGEM-T-CD were ligated by T4 DNA ligase (purchased from TAKALA), and the ligated product was transformed into Escherichia coli JM109 cells. Cultivate overnight at 37°C, pick a single colony on the plate for identification the next day, and name the positive clone pGEM-T-VP28-CD (the construction method is shown in the attached figure 1 shown).

[0046] The expression vector pcDNA3.1(-) (purchased from Invitrogen) and the recombinant cloning ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-prawn white spot syndrome virus (WSSV) recombinant Salmonella typhimurium strain, and a preparation method and an application thereof. The preparation method comprises the steps of: extracting WSSV genomic DNA from an infected prawn, and obtaining WSSV envelope protein VP28 genes by a PCR method; extracting total RNA from a silkworm fat body, and obtaining silkworm antimicrobial peptide CD genes by a reverse transcription PCR method; constructing an eukaryotic expression plasmid pcDNA3.1(-)-VP28-CD containing the WSSV envelope protein VP28 genes and the silkworm antimicrobial peptide CD genes; and transforming into attenuated Salmonella typhimurium W0420 strain competent cells. The WSSV recombinant Salmonella typhimurium strain can be used for preparing a vaccine, which can be directly orally fed prawns. Compared with the current commonly used protein vaccines and injectable DNA vaccines, the inventive vaccine has double functions of inhibiting WSSV infection and enhancing prawn immunity.

Description

technical field [0001] The invention relates to the technical field of genetic bioengineering, more specifically to a recombinant Salmonella typhimurium strain resistant to prawn white spot syndrome virus, which involves the VP28 gene of the wssv envelope protein of prawn white spot syndrome virus and the CD gene of silkworm antimicrobial peptide, and also relates to The invention discloses a method for preparing a genetically engineered bacterium which takes attenuated Salmonella typhimurium W0420 as a host and carries a plasmid of pcDNA3.1(-)-VP28-CD. The invention also relates to the use of the bacterial strain in the preparation of antiviral medicines for preventing or treating prawns. Background technique [0002] In 1987 and 1988, the large-scale outbreak of prawn white spot syndrome occurred for the first time in the world, and the large-scale death of Penaeus monodon cultured in Taiwan area of ​​my country occurred. White spots such as white spots, the disease spread...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N1/21C12N15/79A61K35/74A61K48/00A61P31/20A61P37/04C12R1/42
CPCY02A50/30
Inventor孟小林徐进平鲁伟王健孟海洋朱薇
Owner施成华