Fusion polypeptide with antimicrobial and wound healing promoting function

A fusion polypeptide and wound healing technology, applied in the field of biomedicine, can solve the problems of low yield of naturally extracted antimicrobial peptides, too small molecular weight of antimicrobial peptides, and difficulty in separation and purification, so as to accelerate wound healing, increase molecular weight, and reduce separation and purification. effect of difficulty

Inactive Publication Date: 2008-12-31
LIAONING UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] (1) Antimicrobial peptide molecular weight is too small to cause degradation during expression
[0005] (2) Since antimicrobial peptides are a type of small molecule peptides, it is difficult to separate and purify
[0007] (4) Low yield and high cost of naturally extracted antimicrobial peptides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Fusion polypeptide with antibacterial and wound healing functions

[0028] (1) Eukaryotic expression of hEGF-antimicrobial peptide fusion polypeptide

[0029] Design primers P1 (see SEQ ID NO.5 in the sequence listing for the sequence), P2 (see SEQ ID NO.6 in the sequence listing for the sequence), P3 (see SEQ ID NO.7 in the sequence listing for the sequence) and P4 according to the DNA sequence of hEGF (see SEQ ID NO.8 in the sequence listing for the sequence) for constructing human epidermal growth factor gene (hEGF); specific primers E1 (see SEQ ID NO.9 in the sequence listing for the sequence) and E2 (see SEQ ID NO.9 in the sequence listing for the sequence) .10), used to amplify hEGF and add EcoR I restriction site and thrombin restriction site to its 5' and 3' ends respectively.

[0030] P1: AATAGTGACTCTGAATGTCCCCTGTCCCACGATGGGTACTGCCTCCATGATGGTG;

[0031] P2: CATACTTGTCCAATGCTTCAATATACATGCACACACCATCATGGAGGCAGTACC;

[0032] P3: TGAAGCATTGGACAAGTATGCAT...

Embodiment 2

[0043] Example 2: Antibacterial experiment of fusion polypeptide thrombin digestion product

[0044] Antibacterial activity in vitro was detected by agar diffusion method. The tested strains were the standard strain of Bacillus cereus (CGMCC1.126); hemorrhagic Escherichia coli O157, Acinetobacter baumann's hemolyticus, Enterobacter aerogenes, Staphylococcus auris, Klebsiella pneumoniae, Staphylococcus aureus, B Salmonella paratyphi type, Pseudomonas aeruginosa isolates. The undigested fusion polypeptide and normal saline were used as controls. The results showed that the enzyme-digested polypeptide had a strong killing effect on all the above-mentioned tested strains, and the diameter of the inhibition zone was greater than 20 mm (Ф<8 mm was regarded as having no antibacterial activity). There was no significant difference in the diameter of the inhibition zone among different strains. Undigested fusion polypeptide and saline have no antibacterial activity.

Embodiment 3

[0045] Example 3: Mitogenic activity experiment of fusion polypeptide thrombin cleavage product

[0046] Primary cultured rat lung fibroblasts and human embryonic kidney HEK293 cell lines were used as test cells. The cell growth-promoting activity of fusion polypeptide digestion products was analyzed by MTT method, and human epidermal growth factor (hEGF) standard was used as positive control, and Hanks buffer was used as negative control. The test results showed that both the thrombin cleavage product of the fusion polypeptide and hEGF could significantly promote cell division, and there was no significant difference between them, but the difference was extremely significant compared with the negative control.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion polypeptide with anti-bacterial and wound-healing promotion functions. The technical proposal adopted by the invention is that the fusion polypeptide with anti-bacterial and wound-healing promotion functions comprises a human epidermal growth factor of the amino acid sequence described in a sequence form SEQ ID NO.1, a thrombin protein cutting site of the amino acid sequence described in a sequence form SEQ ID NO.2, and a Rana chensinensis antimicrobial peptide of the amino acid sequence described in a sequence form SEQ ID NO.3; the thrombin protein cutting site enables the human epidermal growth factor to be fused with the Rana chensinensis antimicrobial peptide so as to construct a fusion polypeptide which has the amino acid sequence described in a sequence form SEQ ID NO.4. The fusion polypeptide of the invention has good stability and is provided with broad-spectrum antimicrobial and cell division promotional functions after digestion; the fusion polypeptide is infused in forms of gel agents and spraying agents and other agent types and can be applied to the burning, injury and other trauma treatment of human and mammals; the fusion polypeptide has the effects of preventing wound infection and accelerating wound healing.

Description

Technical field: [0001] The invention belongs to the field of biomedicine, in particular to a fusion polypeptide with antibacterial and wound healing functions. Background technique: [0002] The moist and bare skin of amphibians undoubtedly provides convenient conditions for the invasion of external microorganisms. In order to survive and adapt to the diverse ecological environment of their habitats, they rely on skin glands to secrete a series of antimicrobial peptides to defend against the invasion of external pathogens. invasion. Antimicrobial peptides have multiple biological functions such as high-efficiency and broad-spectrum anti-bacteria, fungi, viruses, parasites, tumors, endotoxins, immune chemotaxis, and promotion of wound repair. They have become the first line of defense for the innate immunity of amphibians. Amphibians have a wide variety of antimicrobial peptides with different functions, which constitute the natural resource pool of antimicrobial peptides. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/81A61K38/17A61P17/02
Inventor王秋雨金莉莉李强冯恺
OwnerLIAONING UNIVERSITY