Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method and application of artificial antimicrobial peptide MA-D4

An antibacterial peptide and artificial technology, applied in the field of genetic engineering, can solve the problems of hemolytic activity and low biological activity of natural antibacterial peptides, and achieve the effect of strong broad-spectrum antibacterial activity, good stability and inhibition of Gram-negative bacteria

Inactive Publication Date: 2015-07-08
刘诚
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to solve the problem of low biological activity and hemolytic activity of existing natural antimicrobial peptides, to provide an artificial antimicrobial peptide MA-D4 with high biological activity and no hemolytic activity, and a large-scale production-based High-efficiency preparation method of bacillus expression system, while providing artificial antimicrobial peptide MA-D4 for the application of various bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of artificial antimicrobial peptide MA-D4
  • Preparation method and application of artificial antimicrobial peptide MA-D4
  • Preparation method and application of artificial antimicrobial peptide MA-D4

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Construction of prokaryotic expression vectors and genetically engineered bacteria.

[0023] According to the mature peptide amino acid sequences of the antimicrobial peptide Magainin (No. 474452717) and Dermaseptin-4 (No. P84924.1) in GenBank, the methionine (Met) at position 21 of the antimicrobial peptide Magainin was replaced with tryptophan (Trp) , artificially designed the amino acid sequence SEQ ID No.1 of the artificial antimicrobial peptide MA-D4 of the present invention, wherein DDDDK is the cleavage site of enterokinase. Then the nucleotide sequence encoding the antimicrobial peptide was designed using E. coli preferred codons, and nucleic acid restriction endonucleases were added at both ends xho with Bam H Identify the site to form the target gene, the sequence of which is shown in SEQ ID No.2.

[0024] The designed target gene sequence is 5′-cac ctcgag gatgatgatgataaacatcatggtattggtaaatttctgcatagcgcaaaaa

[0025] aatttggtaaagcatttgttg...

Embodiment 2

[0029] Example 2: Acquisition and purification of artificial antimicrobial peptide MA-D4.

[0030] Use enterokinase to digest the expression product according to the following enzyme digestion system: 10×Buffer 10.0 μL, ddH 2 O 38.0 μL, target protein 50.0 μL, enterokinase 2.0 μL, placed at 23°C for 20h.

[0031] The artificial antimicrobial peptide MA-D4 of the present invention was obtained by purifying the HisPur Ni-NTA Spin Purification Kit from Thermo Scientific through nickel ion affinity chromatography. After pretreating the resin column according to the instructions, add the enzyme-cut supernatant equal to the amount of High-capacity nickel-IMAC resin, place it in a 4°C environment for 1 hour, elute the protein, and collect the eluate for SDS- PAGE detection, see appendix figure 2 . It can be seen that there is an obvious protein band between 4.6-10.0kD, which is in line with the experimental design size, which is the artificial antimicrobial peptide MA-D4. Its co...

Embodiment 3

[0032] Example 3: Detection of the biological activity of the artificial antimicrobial peptide MA-D4.

[0033] Determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of artificial antimicrobial peptide MA-D4 against E. coli, Staphylococcus aureus, Bacillus subtilis, Pseudomonas aeruginosa, Streptococcus suis type 2 and Bacillus anthracis by microdilution method ). The specific experimental steps are as follows: the experimental strains were prepared into 10 6 Cfu / mL bacterial solution was added to 96-well cell culture plates, 90 μL per well. The artificial antimicrobial peptide MA-D4 solution was diluted to 40.0, 20.0, 10.0, 8.0, 6.0, 4.0, 2.0, 1.0, 0.5 μg / mL with PBS, and added to a 96-well cell culture plate, 10 μL per well. The blank control group was set to contain only LB liquid medium, the conditional control group only contained the bacterial solution of the experimental strain, and the enzyme digestion control group was a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method of an application of an artificial antimicrobial peptide MA-D4. According to the invention, an amino acid sequence of the artificial antimicrobial peptide MA-D4 is designed artificially, and a nucleotide sequence encoding the antimicrobial peptide is designed by using an escherichia coli preference codon; a target gene is synthesized by an overlap region amplification gene splicing method, and a prokaryotic expression vector is constructed and is transformed into the escherichia coli BL21 or Rosetta for inducing expression; an expressed product is subjected to digestion treatment by enterokinase and is subjected to nickel ion affinity chromatography purification, so as to obtain the artificial antimicrobial peptide MA-D4. The antimicrobial peptide has higher broad-spectrum antibacterial activity, can inhibit gram-positive bacteria and gram-negative bacteria, and meanwhile, excludes hemolytic activity. Therefore, as a novel antimicrobial drug, the antimicrobial peptide has excellent application prospect on the aspects of food preservation, disease treatment and the like, and has very high developing potential. The preparation method is high in expression efficiency, easy in separation and purification, low in production cost and good in stability, therefore, the preparation method can be used for mass production.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a preparation method and application of artificial antibacterial peptide MA-D4. Background technique [0002] The long-term inappropriate application of antibiotics in clinical treatment has resulted in the obvious drug resistance of many pathogenic bacteria, which has become a major problem threatening human and animal health. What is more serious is the emergence of multi-drug resistant strains clinically. The superbug NDM-1 discovered in 2010 is even insensitive to most antibiotics. At present, it generally takes about 10 years to develop a new antibiotic, but it only takes 2 years to produce a generation of drug-resistant bacteria. The situation of anti-infection is very severe, and it is imminent to develop and design new antibacterial drugs. [0003] Antimicrobial peptides are a class of small molecular polypeptides produced by the host that can r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/00C12N15/11C12N15/70C12N1/21A61K38/16A61P31/04A23L3/3526C12R1/19
Inventor 刘诚
Owner 刘诚