Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Andrias davidianus cathelicidin-ME2, and coded sequence and purpose thereof

A technology of antimicrobial peptides and giant salamanders, applied in the field of genetic engineering, can solve the problems of high cost of antimicrobial peptides, complex methods of antimicrobial peptides, and low yield, and achieve the effect of inhibiting bacterial growth

Inactive Publication Date: 2018-02-06
广州郡雅科技应用有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The method of directly extracting antimicrobial peptides from Chinese giant salamanders is complicated and the yield is very small; the cost of preparing antimicrobial peptides by chemical synthesis is too high, and there is no possibility of practical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Andrias davidianus cathelicidin-ME2, and coded sequence and purpose thereof
  • Andrias davidianus cathelicidin-ME2, and coded sequence and purpose thereof
  • Andrias davidianus cathelicidin-ME2, and coded sequence and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Acquisition of Chinese giant salamander Cathelicidin-ME2 antimicrobial peptide cDNA

[0041] The inventors used TaKaRa Smart TM The cDNA library construction kit was used to construct the cDNA library of the Chinese giant salamander skin tissue. The clones were randomly picked and sequenced, and the measured sequence was compared with the sequence in the NCBI gene bank (GenBank) by BLAST to obtain the Cathelicidin-ME2 antibacterial peptide. cDNA.

[0042] 1. Extraction of Total RNA from Mucosa Epithelial Tissue of Chinese Giant Salamander

[0043] The Chinese giant salamander mucosal epithelial tissue was taken into cryopreservation tubes, and then the Chinese giant salamander was released. The cryopreservation tubes were placed in liquid nitrogen and transported back to the laboratory, and stored in a liquid nitrogen tank for later use.

[0044] Take 0.1 g of mucosal epithelial tissue and grind it into powder at low temperature with liquid nitrogen. Add ...

Embodiment 2

[0083] Example 2: Recombinant expression of Chinese giant salamander Cathelicidin antimicrobial peptide in Bacillus subtilis

[0084] 1. According to the sequence of SQ ID NO: 2, the primers are calculated as follows:

[0085] P1: 5'-GCAATGACAGCCGTGGGTACA-3';

[0086] P2: 5'-GC AAGCTT AGGGCGAACTCCATCTTGGT - 3' (Introduction of Hind III restriction site).

[0087] Use the pET30a-cathAM plasmid as a template to amplify the Cathelicidin-ME2 gene, and the PCR system is as follows:

[0088]

[0089] Reaction program: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min. PCR products were detected by 1% agarose gel electrophoresis.

[0090] 2. Using the genomic DNA of Bacillus subtilis as a template, primers were set according to the sequence known in Genbank to amplify P 43 Promoter sequence, EcoRI restriction site was introduced into primer P3, and the designed ...

Embodiment 3

[0128] Example 3: Separation and purification of recombinant Chinese giant salamander Cathelicidin-ME2 antimicrobial peptide

[0129] The resulting fermentation supernatant containing the recombinant Chinese giant salamander Cathelicidin-ME2 antimicrobial peptide was replaced with an equilibration buffer (25mM PBS, pH 6.0) through a Sephadex G-25 column, and then applied to a CM sepharose FF cation exchange column. Collect the flow-through peak and wash the column with the aforementioned equilibration buffer until the plateau. Then, use a mixture of solution A (25 mM PBS, pH 8.0) and solution B (25 mM PBS containing 1 M NaCl, pH 8.0) for linear gradient elution, collect each elution peak, and use Tricine / Tris SDS- PAGE electrophoresis (silver staining) analysis (the optimized elution scheme is eluted with 100, 200, 500 mM NaCl in PBS solution). The target peptide was eluted in 25 mM PBS containing 200 mM NaCl, pH 8.0. Finally, the recombinant Chinese giant salamander Catheli...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Chinese giant salamander Cathelicidin-ME2 antimicrobial peptide, a gene encoding the antimicrobial peptide and uses of the antimicrobial peptide. The antimicrobial peptide contains the amino acid sequence shown in SEQ ID NO:1. The gene encoding the antimicrobial peptide contains the base sequence encoding the amino acid sequence shown in SEQ ID NO:1. The antibacterial peptide has obvious inhibitory effect on a variety of bacteria, and the minimum inhibitory concentration (MIC) of Escherichia coli (CMCC44102), Escherichia coli (ATCC25922) and Salmonella typhimurium (CMCC50115) reached 62.5 μg / mL. The antimicrobial peptide can be used to prepare, for example, feed additives, preservatives, agricultural biological control agents, drugs for controlling microbial infections, and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Chinese giant salamander Cathelicidin-ME2 antibacterial peptide, a gene sequence encoding the antibacterial peptide and an application of the antibacterial peptide. Background technique [0002] Due to the indiscriminate use and abuse of antibiotics, many bacteria have produced drug-resistant strains, and the development of new antibiotics is not fast enough, so the contradiction between the development of new antibiotics and the demand for antibacterial is becoming increasingly prominent. In addition, the problem of antibiotic residues in animal products has attracted more and more attention, which directly endangers human health. The unique antibacterial mechanism of antimicrobial peptides provides the possibility to solve this problem, so it is very promising to be developed into a new class of highly effective antibacterial drugs. [0003] Antimicro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/46C12N15/12A23K20/147
CPCC07K14/463A23K20/147
Inventor 不公告发明人
Owner 广州郡雅科技应用有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com