Quick quantitative determination card for canine parvovirus antibody and use method thereof
A technology for quantitative detection of canine parvovirus, applied in the field of detection cards, can solve the problems of narrow detection range and low sensitivity, and achieve the effect of improved sensitivity, high sensitivity and stable performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1. Eukaryotic expression of canine parvovirus structural protein VP2 protein
[0036] Step 1. Primer design and vector construction: According to the canine parvovirus ORF gene sequence published in the GenBank database, design primers to amplify the VP2 sequence, and design its upstream and downstream primers; the upstream primer F is the 5' end of 5'ACTCGAGCTGAAAATATAACTCAATGGAACCTGAGTGACAACG 3' Contains Xho1 restriction site, the downstream primer R is 5'AGGTACCGGCATAAGCGCCAAACCAGGTTTT 3', and the 5' end contains Kpn1 restriction site. The VP2 gene was amplified by PCR using the synthesized ORF gene as a template and F / R as primers.
[0037] Step 2. Construction of the recombinant plasmid: 1% agarose gel electrophoresis was used to detect the PCR product, and the purified VP2 gene fragment was recovered with a DNA purification and recovery kit, and the recovered fragment was subjected to agarose gel electrophoresis to identify whether the band was correct. T...
Embodiment 2
[0040] Example 2: Canine Parvovirus Structural Protein VP2 Protein Using Specific Synthetic Peptides to Prepare Antigen
[0041] A method for preparing the above-mentioned canine parvovirus structural protein VP2 protein, comprising the following steps:
[0042] Step 1. Sequence analysis of canine parvovirus structural protein VP2 protein: use bioinformatics to predict MHC class I molecules: verify through relevant websites or use computer software to analyze the sequence of CPV-VP2 protein to understand its hydrophilicity, hydrophobicity, structure Domain accessibility, sequence variability, α-helix, β-turn, antigenicity and other parameters, and then comprehensive analysis and homology modeling methods to predict its tertiary structure, from which the antigenic reactive epitope and amino acid residues are predicted, The comprehensive analysis design is carried out according to the degree of difficulty of the peptide synthesizer. Each polypeptide chain contains at least one ...
Embodiment 3
[0044] Example 3: Preparation of the detection card for canine parvovirus antibody
[0045] Preparation of canine parvovirus antibody detection standard curve: prepare 6 copies of calibration solution containing canine parvovirus antibody (including canine parvovirus antibody standard), the concentrations are 0, 1 / 1024, 1 / 256, 1 / 64, 1 / 16 respectively , 1 / 4 (canine parvovirus antibody standard double dilution). Add the above-mentioned calibration solutions of different concentrations into the sample holes of the assembled test card, and after 15 minutes of chromatography, the test is carried out by a tomographic scanner, and the test results obtained 6 times are processed by the client, and the client calculates The fluorescence signal intensity values of the detection line and quality control line corresponding to the standard, and perform linear regression based on this data to make a standard curve for canine parvovirus antibody. The standard curve calculated by the client...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


