Unlock instant, AI-driven research and patent intelligence for your innovation.

Quick quantitative determination card for canine parvovirus antibody and use method thereof

A technology for quantitative detection of canine parvovirus, applied in the field of detection cards, can solve the problems of narrow detection range and low sensitivity, and achieve the effect of improved sensitivity, high sensitivity and stable performance

Inactive Publication Date: 2018-03-20
杭州微瑞科技有限公司
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Enzyme-labeled kits for detecting canine parvovirus antibodies are widely used in the market. ELISA kits require microplate readers, incubation reaction conditions, plate washing conditions, operating environment and professional technicians. In addition, complex pre-treatments are required for detection samples, such as Collect blood, separate serum, etc.; while rapid colloidal gold detection is convenient and does not require professional technicians and working environment, but its detection sensitivity is low, and it can only be qualitative, and the detection range is narrow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quick quantitative determination card for canine parvovirus antibody and use method thereof
  • Quick quantitative determination card for canine parvovirus antibody and use method thereof
  • Quick quantitative determination card for canine parvovirus antibody and use method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1. Eukaryotic expression of canine parvovirus structural protein VP2 protein

[0036] Step 1. Primer design and vector construction: According to the canine parvovirus ORF gene sequence published in the GenBank database, design primers to amplify the VP2 sequence, and design its upstream and downstream primers; the upstream primer F is the 5' end of 5'ACTCGAGCTGAAAATATAACTCAATGGAACCTGAGTGACAACG 3' Contains Xho1 restriction site, the downstream primer R is 5'AGGTACCGGCATAAGCGCCAAACCAGGTTTT 3', and the 5' end contains Kpn1 restriction site. The VP2 gene was amplified by PCR using the synthesized ORF gene as a template and F / R as primers.

[0037] Step 2. Construction of the recombinant plasmid: 1% agarose gel electrophoresis was used to detect the PCR product, and the purified VP2 gene fragment was recovered with a DNA purification and recovery kit, and the recovered fragment was subjected to agarose gel electrophoresis to identify whether the band was correct. T...

Embodiment 2

[0040] Example 2: Canine Parvovirus Structural Protein VP2 Protein Using Specific Synthetic Peptides to Prepare Antigen

[0041] A method for preparing the above-mentioned canine parvovirus structural protein VP2 protein, comprising the following steps:

[0042] Step 1. Sequence analysis of canine parvovirus structural protein VP2 protein: use bioinformatics to predict MHC class I molecules: verify through relevant websites or use computer software to analyze the sequence of CPV-VP2 protein to understand its hydrophilicity, hydrophobicity, structure Domain accessibility, sequence variability, α-helix, β-turn, antigenicity and other parameters, and then comprehensive analysis and homology modeling methods to predict its tertiary structure, from which the antigenic reactive epitope and amino acid residues are predicted, The comprehensive analysis design is carried out according to the degree of difficulty of the peptide synthesizer. Each polypeptide chain contains at least one ...

Embodiment 3

[0044] Example 3: Preparation of the detection card for canine parvovirus antibody

[0045] Preparation of canine parvovirus antibody detection standard curve: prepare 6 copies of calibration solution containing canine parvovirus antibody (including canine parvovirus antibody standard), the concentrations are 0, 1 / 1024, 1 / 256, 1 / 64, 1 / 16 respectively , 1 / 4 (canine parvovirus antibody standard double dilution). Add the above-mentioned calibration solutions of different concentrations into the sample holes of the assembled test card, and after 15 minutes of chromatography, the test is carried out by a tomographic scanner, and the test results obtained 6 times are processed by the client, and the client calculates The fluorescence signal intensity values ​​of the detection line and quality control line corresponding to the standard, and perform linear regression based on this data to make a standard curve for canine parvovirus antibody. The standard curve calculated by the client...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quick quantitative determination card for a canine parvovirus antibody and a use method thereof. The quick quantitative determination card comprises a detection card casing and a test strip assembled in the detection card casing, wherein the test strip comprises a plastic bottom plate with pressure sensitive adhesive, and a sample pad, a marker pad, a nitrocellulose membrane and absorbent paper are sequentially bonded to the bottom plate; the marker pad comprises a carrier base layer and a marker; the marker is a layer of membrane which is formed by spraying lanthanide-series fluorescence detection microspheres and lanthanide-series fluorescence quality control microspheres on the carrier base layer; the nitrocellulose membrane shows a detection line when being coated with a canine parvovirus recombinant antigen and shows a quality control line when being coated with a rabbit anti-chicken lgY antibody; the marker is fluorescence detection microspheres marked with a canine parvovirus structural protein VP2 recombinant antigen and fluorescence quality control microspheres marked with a chicken lgY antibody. The quick quantitative determination card disclosedby the invention can achieve in-site quick quantitative detection on the canine parvovirus antigen and has higher practical value and popularization value.

Description

technical field [0001] The invention relates to a detection card and its use, in particular to a rapid quantitative detection card for canine parvovirus antibody and its use method. Background technique [0002] Canine parvovirus (CPV) is a contagious virus that mainly infects dogs. The disease is highly contagious. The disease is transmitted between dogs through direct or indirect contact with their feces. Canine parvovirus is a non-enveloped, single-negative strand DNA virus composed of three structural proteins, VP1, VP2 and VP3. Where VP2 is its protective particle antigen. Studies have shown that VP2 can induce neutralizing antibodies in dogs and protect dogs against virulent challenge. The virion is very small, 20-22 nm in diameter, and has icosahedral symmetry. CPV is a member of the genus Parvovirus in the family Parvoviridae. Canine parvovirus disease has a close antigenic component relationship with feline panleukopenia. [0003] Canine parvovirus disease, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68
CPCG01N33/68
Inventor 吴俊清章健吴冠英王泽洲
Owner 杭州微瑞科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More