A kind of thermophilic fungus cutinase and its coding gene and application

A protein and amino acid technology, applied in applications, fungi, genetic engineering, etc., can solve the problem of low expression

Active Publication Date: 2021-06-08
CHINA AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there have been many reports on cutinase gene expression, the expression level is still not high, and strains with high cutinase production remain to be discovered

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of thermophilic fungus cutinase and its coding gene and application
  • A kind of thermophilic fungus cutinase and its coding gene and application
  • A kind of thermophilic fungus cutinase and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1, expression of C. camphorii cutinase in recombinant Pichia pastoris

[0057] 1. Construction of recombinant bacteria

[0058] Using the cDNA of C. camphorii cutinase as a template, according to the reported fungal cutinase amino acid sequence, use the online software Block Maker (http: / / blocks.fhcrc.org / blocks / blockmkr / make_blocks.html) to search for the conserved region, Then use the online primer design software CODEHOP (http: / / blocks.fhcrc.org / codehop.html) to design degenerate primers, upstream primer McCutEcoRIF: 5'-tgcga GAATTC TCCCCAGTTGCAGTGGAGA-3' (the underline indicates the EcoRI restriction site, and the sequence after the underline is the same as the 49th-67th position in Sequence 1 in the sequence listing) and the downstream primer McCutNotIR: tgcga GCGGCCGC TTACGAGAGTCTATCCTCAAGCC (the underline indicates the Not I restriction site, and the sequence after the underline matches the 626th to 648th positions in Sequence 1 in the Sequence List...

Embodiment 2

[0069] Embodiment 2, purification and enzymatic properties of cutinase

[0070] 1. Definition and determination method of cutinase enzyme activity

[0071] The enzymatic activity of cutinase was determined with reference to the method of Xu et al. (Xu et al., Characterization of anacidic cold-adapted cutinase from Thielavia terrestris and its application flavor ester synthesis. Food Chemistry, 2015, 188: 439-445). Add 50 μL of appropriately diluted cutinase solution to 400 μL of 50 mM Tris-HCl buffer (pH 8.0), preheat in a 45°C water bath for 2 min, add 50 μL of 20 mM p-nitrophenylbutyrate in isopropanol and react for 10 min. After the reaction was completed, 500 μL of 300 mM phosphate buffer (pH 7.0) containing 5% (w / v) SDS (sodium dodecyl sulfate) was added. Finally, absorbance was measured at 410 nm. Enzyme activity unit (U) is defined as: under the above conditions, the amount of cutinase required to produce 1 μmol of p-nitrophenol per minute. Specific enzyme activity i...

Embodiment 3

[0083] Embodiment 3, cutinase hydrolysis butter

[0084] Hydrolysis of butter with cutinase: Mix 1g of butter with 1g of 50mM phosphate buffer (pH 8.0), add 1500-4000U / g of cutinase, and hydrolyze at 45°C and 200rpm. After 12 hours of hydrolysis, add 15 mL of ether: ethanol (2:1, v / v) mixed solvent, and then titrate with 0.1 mol / L KOH solution to determine the acid value.

[0085] Gas chromatography-mass spectrometry (GC-MS) detection of reaction products: After hydrolysis, take the upper oil sample, add n-hexane to dilute, mix well, and perform GC-MS detection. The chromatographic column DB-WAX (30m×0.25mm×0.25μm) was used, the injection volume was 1μL, the split ratio was 1:20, He was used as the carrier gas, and the flow rate was 1.5mL / min; 2min, 5°C / min to 210°C, hold for 5min; GC / MS interface temperature 250°C, EI ion source, ion source temperature 220°C, electron energy 70eV, mass spectrometry scanning range 33-450aum.

[0086] When the amount of cutinase added was 300...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a thermophilic fungus cutinase, its coding gene and application. The cutinase is a protein of the following 1) or 2) or 3): 1) a protein consisting of the amino acid sequence shown in sequence 2 in the sequence listing; 3) The protein shown in 1) or 2) undergoes substitution and / or deletion and / or addition of one or several amino acid residues and has cutinase activity. The recombinant bacteria formed by introducing the protein coding gene into Pichia pastoris were fermented at high density in a 5L fermenter, and the enzyme activity of the fermentation broth could reach 12536U / mL, and the protein content was 10.8mg / mL. The cutinase can hydrolyze butter to prepare milky flavor; catalyze the esterification reaction of short carbon chain alcohol and acid to synthesize flavor ester. The cutinase has good thermal stability and high enzyme production level, and has the potential of industrial production and application.

Description

technical field [0001] The invention relates to a thermophilic fungus Cladosporium camphor cutinase and its encoding gene and application, belonging to the field of biotechnology. Background technique [0002] Cutinase (EC 3.1.1.74) is a hydrolase capable of degrading cutin and is a member of the α / β hydrolase family with a smaller molecular weight. Cutinase has a wide range of substrate specificity and can hydrolyze soluble esters, insoluble triglycerides and natural polyesters; in addition, cutinase can also catalyze esterification and transesterification reactions. Therefore, cutinase is widely used in food industry, textile industry, biodegradation, detergent, synthetic biodiesel and many other fields (Zhang Xiaoning et al. Progress in research and application of cutinase, China Brewing, 2013, 32(11): 11-17). In the food industry, cutinase can catalyze esterification and transesterification reactions to synthesize flavor esters (Dutta&Dasu, Synthesis of short chain alk...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/18C12N15/55C12N15/81C12N1/19C12P7/62C12P7/64A23L27/20C12R1/84
CPCC12N9/18C12N15/815C12P7/62C12P7/6418C12Y301/01074
Inventor江正强段晓杰闫巧娟刘瑜杨绍青
OwnerCHINA AGRI UNIV