Method for continuously preparing [14/15N]-L-citrulline by immobilized enzyme
An immobilized enzyme, pxmj19-cipa-arc technology, applied in recombinant DNA technology, introduction of foreign genetic material using a carrier, fermentation, etc., can solve problems such as increased production cost, complicated operation, and low substrate concentration
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Embodiment 1 Contains the construction of arginine deiminase genetically engineered bacteria
[0064] 1.1 According to the cipA gene sequence reported by Kirsten Jung et al. (2017), the coding region DNA optimized according to the codon bias of Corynebacterium glutamicum was chemically synthesized. The chemical synthesis was completed by Suzhou Jinweizhi Biotechnology Company. The cipA gene sequence is as follows:
[0065] ATGATCAACGACATGCACCCATCCCTGATCAAGGACAAGGACATGATGGACGACGTTATGCTGCGCTCCTGCAAGATCATCGCTATGAAGATCATGCCAGACAAGGTTATGCAGGTTATGGTTACCGTTCTGATGCTGGACGGCACCTCCGAGGAGATGCTGCTGAAGTGGAACCTGCTGGACAACCGCGGCATGGCTATCTACAAGGTTCTGATGGAGGCTCTGTGCGGCAAGAAGGACGTTAAGATCGGCACCGTTGGCAAGGTTGGCCCACTGGGCTGCGACTACATCAACTGCGTTGAGATCTCCATG
[0066] The synthetic gene sequence (SEQ ID NO.1) was introduced into the HindIII site at the 5' end of the DNA, and the SalI site was introduced at the 3' end. After the synthetic fragment was sequenced, the target gene and the expression ve...
Embodiment 2
[0071] Embodiment 2 fusion protein cipA-arc expression
[0072] 2.1 Preparation of Competent Cells of Corynebacterium glutamicum
[0073] Streak Corynebacterium glutamicum ATCC13032 on a plate containing LBG solid medium and cultivate it in a 300C incubator. Min shaker culture 12-24h. The activated bacterial solution was transferred to LBG medium according to the inoculum amount of 1%, and cultivated in a shaker at a temperature of 30° C. and a rotation speed of 200 r / min until the OD600 was about 0.9. Pre-cool the bacterial solution in the ice-water mixture for 15-20 minutes, then divide the pre-cooled bacterial solution into sterilized 50mL centrifuge tubes in an ultra-clean bench, centrifuge at 6000g at 4°C for 30s, and place in ice water for 2 minutes. Aspirate the supernatant in the centrifuge tubes, quickly add 2.5 mL of pre-cooled 10% glycerol to the centrifuge tubes, and blow slowly with a pipette until the cells are suspended. Centrifuge the suspension at 6000g at ...
Embodiment 3
[0080] Embodiment 3 fusion protein cipA-arc expression
[0081] Except that the culture temperature in step 2.1 is 20° C., the rotation speed during culture is 300 r / min, and the culture to OD600 is about 0.3, other experimental conditions and experimental steps are the same as in Example 2.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

![Method for continuously preparing [14/15N]-L-citrulline by immobilized enzyme](https://images-eureka.patsnap.com/patent_img/c3745916-9243-440c-b9f0-6776b4976ae1/BDA0002463732850000111.png)
![Method for continuously preparing [14/15N]-L-citrulline by immobilized enzyme](https://images-eureka.patsnap.com/patent_img/c3745916-9243-440c-b9f0-6776b4976ae1/BDA0002463732850000112.png)
![Method for continuously preparing [14/15N]-L-citrulline by immobilized enzyme](https://images-eureka.patsnap.com/patent_img/c3745916-9243-440c-b9f0-6776b4976ae1/BDA0002463732850000121.png)