Unlock instant, AI-driven research and patent intelligence for your innovation.

Expression vector of membrane protein SohB and expression and purification method of membrane protein SohB

An expression vector, expression and purification technology, applied in the field of protein production, can solve the problems of difficult protein expression and resistance to drug-resistant bacteria, and achieve the effect of improving transcription and translation efficiency

Pending Publication Date: 2021-07-16
NANJING UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] As a commonly used expression host, Escherichia coli has always been the first choice for protein expression. However, even E. coli proteins are difficult to express in large quantities in E. coli
At present, due to the abuse of antibiotics, it will be impossible to fight against drug-resistant bacteria in the next 50 years

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector of membrane protein SohB and expression and purification method of membrane protein SohB
  • Expression vector of membrane protein SohB and expression and purification method of membrane protein SohB
  • Expression vector of membrane protein SohB and expression and purification method of membrane protein SohB

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The gene cloning of embodiment 1SohB

[0032] 1. Cloning of SohB

[0033] a) Design a new SohB coding sequence (SEQ ID NO.1) based on comparing the codons used in the SohB sequence with the codon usage frequency of Escherichia coli in the Kazusa online database (http: / / www.kazusa.or.jp / codon / ) , and synthesized. Then amplified by PCR method. The PCR reaction system configuration is shown in Table 1.

[0034] Table 1 PCR reaction system preparation table

[0035]

[0036]

[0037] PCR results such as figure 1 shown. The target fragment length is 1068bp, and the optimal annealing temperature is 52°C.

[0038] b) Recover the target DNA, digest the target fragment and pLy077 vector with NcoI and BamHI, and then perform agarose gel electrophoresis to recover the digested product; add the recovered target fragment and pLy077 vector fragment at a molar ratio of 5:1 In a small centrifuge tube, add T4 ligase and ligate overnight at 16°C.

[0039] c) 20 μL of the ab...

Embodiment 2

[0042] Expression of embodiment 2 SohB

[0043] Induced Expression of Fusion Protein SohB-Superfolded Fluorescent Protein

[0044] The correctly identified pLy077-SohB plasmid was transferred into Escherichia coli expression host BL21 (DE3) and DH5α, and spread on the colony containing 0.1 mM isopropylthiogalactopyranoside (IPTG) to obtain stable transformation; through the detection of colony fluorescence detection, Figure 5 In order to transform the colony fluorescence image on the agar plate, whether the colony contains a recombinant plasmid can be known from the presence or absence of fluorescence, and the colony containing the recombinant plasmid shows fluorescence, and it can be seen that a large number of mutants expressing the target protein have been obtained.

[0045]Inoculate a single colony into LB and TB liquid medium containing 100 μg / ml ampicillin, respectively, and culture overnight at 200 rpm at 37°C to obtain overnight bacteria. Inoculate the overnight bac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression vector of membrane protein SohB and an expression and purification method of the membrane protein SohB. The nucleotide sequence of the expression vector is shown as SEQ ID NO.2, and the expression vector comprises a phage T7 promoter; an escherichia coli ribosome binding site, which comprises an NcoI sequence CCATGG, an escherichia coli membrane protein SohB sequence as shown in SEQ ID NO. 1, and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; an NdeI enzyme cutting site CATATG; a super-folded Venus fluorescent protein coding sequence; an XhoI enzyme cutting site is CTCGAG; and 6 histidine sites and a termination codon TAG. According to the present invention, a fluorescent protein with molecular rigidity is used as a selection marker and an expression process indicator, and the fluorescent protein can be quickly folded due to a molecular level rigid structure, so as to help the nitrogen-terminal membrane protein SohB stabilize the conformation of the nitrogen-terminal membrane protein SohB. The expression vector constructed by the invention can realize mass expression of the membrane protein SohB, and can be used for high-throughput screening of subsequent novel antibiotics.

Description

technical field [0001] The invention belongs to the technical field of protein production, and relates to an expression carrier of unknown function transporter (SohB) and an expression purification method thereof. Background technique [0002] The cell membrane is the boundary between the inside and outside of the cell, and is responsible for the important functions of information transmission, energy transmission and material exchange, and is the most important organelle. The target of drug action is often located on the cell membrane. More than 50% of known drug targets are membrane proteins. Therefore, the study of membrane proteins is of great significance. [0003] However, due to the rare content of membrane proteins in their natural state and their multiple transmembrane structures, folding errors are prone to occur and their structures are complex. Therefore, the large-scale preparation of membrane proteins has always been a difficulty and hot spot. In China, ther...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N1/21C07K14/245C12R1/19
CPCC12N15/70C12N1/20C07K14/245Y02A50/30
Inventor 周敏张苑桢陈宇航
Owner NANJING UNIV OF SCI & TECH