Novel beta-glucosidase and genes thereof and application of beta-glucosidase to glucoside synthesis
A technology of glucosidase and monosaccharide, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of β-glucosidase not being stable enough, easily inhibited by high concentration of glucose, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Cloning of embodiment 1β-glucosidase gene
[0059] According to the gene sequence (Genebank accession number: NC011297) of Dictyoglomus thermophilum β-glucosidase recorded in Genbank, the PCR primers were designed as follows:
[0060] Upstream primer: CGC GGATCC ATGGCTAAATTAGTTTTTCCTAA;
[0061] Downstream primer: CCG CTCGAG CCCATCTACTCCATTCTCTTTCAA.
[0062] Wherein, the underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the XhoI restriction site.
[0063] The genomic DNA of Dictyoglomus thermophilum DSM 3960 was used as a template for PCR amplification. The PCR system is: 10 μl of 2×Taq PCRMasterMix, 1 μl (0.3 μmol / l) of each upstream primer and downstream primer, 1 μl (0.1 μg) of DNA template and ddH 2 O 7 μl. PCR amplification steps are: (1) Pre-denaturation at 95°C for 3 minutes; (2) Denaturation at 94°C for 1 minute; (3) Annealing at 55°C for 30 seconds; (4) Extension at 72°C for 1.5 minu...
Embodiment 2
[0064] Embodiment 2 Preparation of recombinant expression vector (plasmid) and recombinant expression transformant
[0065] The β-glucosidase gene DNA fragment obtained in Example 1 was double-digested with restriction endonucleases BamHI and XhoI at 37°C for 12 hours, purified by agarose gel electrophoresis, and the target was recovered using an agarose gel DNA recovery kit fragment. Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET21a digested with BamHI and XhoI at 4°C overnight to obtain the recombinant expression plasmid pET-DtGH.
[0066] Transform the above recombinant expression plasmids into Escherichia coli (E.coli) DH5α competent cells, screen the positive recombinants on the ampicillin-containing resistance plate, pick single clones, and verify the positive clones by colony PCR . Cultivate the recombinant bacteria, extract the plasmid after the amplification of the plasmid, and retransform into Escherichia coli (E.coli) BL21 ...
Embodiment 3
[0067] Expression of embodiment 3 recombinant β-glucosidase
[0068] The recombinant Escherichia coli (E.coli) BL21(DE3) / pET-DtGH obtained in Example 2 was inoculated into the LB medium containing ampicillin (peptone 10g / l, yeast extract 5g / l, NaCl 10g / l, pH 7.0), 37 ° C shaking culture overnight, according to the 1% (v / v) inoculum size into the 500ml Erlenmeyer flask equipped with 100ml LB medium, put 37 ° C, 180rpm shaker shaking culture, when the culture medium OD 600 When it reaches 0.6, add IPTG with a final concentration of 0.35mmol / l as an inducer, and after induction at 37°C for 5 hours, centrifuge the culture medium to collect the cells and wash them twice with physiological saline to obtain resting cells. Suspend the obtained quiescent cells in a pH 7.0 buffer, ultrasonically break in an ice bath, and centrifuge to collect the supernatant, which is the crude enzyme solution of the recombinant β-glucosidase. The crude enzyme solution was analyzed by polyacrylamide g...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
