Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel beta-glucosidase and genes thereof and application of beta-glucosidase to glucoside synthesis

A technology of glucosidase and monosaccharide, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of β-glucosidase not being stable enough, easily inhibited by high concentration of glucose, etc.

Inactive Publication Date: 2012-09-19
EAST CHINA UNIV OF SCI & TECH
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is to provide a high catalytic activity, thermal β-glucosidase with good stability, good tolerance to high glucose concentration, stable in low water content system and short reaction time, recombinant expression vector containing the gene, recombinant expression transformant and its efficient preparation method, and the Application of β-glucosidase in Catalyzing Glycoside Synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel beta-glucosidase and genes thereof and application of beta-glucosidase to glucoside synthesis
  • Novel beta-glucosidase and genes thereof and application of beta-glucosidase to glucoside synthesis
  • Novel beta-glucosidase and genes thereof and application of beta-glucosidase to glucoside synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Cloning of embodiment 1β-glucosidase gene

[0059] According to the gene sequence (Genebank accession number: NC011297) of Dictyoglomus thermophilum β-glucosidase recorded in Genbank, the PCR primers were designed as follows:

[0060] Upstream primer: CGC GGATCC ATGGCTAAATTAGTTTTTCCTAA;

[0061] Downstream primer: CCG CTCGAG CCCATCTACTCCATTCTCTTTCAA.

[0062] Wherein, the underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the XhoI restriction site.

[0063] The genomic DNA of Dictyoglomus thermophilum DSM 3960 was used as a template for PCR amplification. The PCR system is: 10 μl of 2×Taq PCRMasterMix, 1 μl (0.3 μmol / l) of each upstream primer and downstream primer, 1 μl (0.1 μg) of DNA template and ddH 2 O 7 μl. PCR amplification steps are: (1) Pre-denaturation at 95°C for 3 minutes; (2) Denaturation at 94°C for 1 minute; (3) Annealing at 55°C for 30 seconds; (4) Extension at 72°C for 1.5 minu...

Embodiment 2

[0064] Embodiment 2 Preparation of recombinant expression vector (plasmid) and recombinant expression transformant

[0065] The β-glucosidase gene DNA fragment obtained in Example 1 was double-digested with restriction endonucleases BamHI and XhoI at 37°C for 12 hours, purified by agarose gel electrophoresis, and the target was recovered using an agarose gel DNA recovery kit fragment. Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET21a digested with BamHI and XhoI at 4°C overnight to obtain the recombinant expression plasmid pET-DtGH.

[0066] Transform the above recombinant expression plasmids into Escherichia coli (E.coli) DH5α competent cells, screen the positive recombinants on the ampicillin-containing resistance plate, pick single clones, and verify the positive clones by colony PCR . Cultivate the recombinant bacteria, extract the plasmid after the amplification of the plasmid, and retransform into Escherichia coli (E.coli) BL21 ...

Embodiment 3

[0067] Expression of embodiment 3 recombinant β-glucosidase

[0068] The recombinant Escherichia coli (E.coli) BL21(DE3) / pET-DtGH obtained in Example 2 was inoculated into the LB medium containing ampicillin (peptone 10g / l, yeast extract 5g / l, NaCl 10g / l, pH 7.0), 37 ° C shaking culture overnight, according to the 1% (v / v) inoculum size into the 500ml Erlenmeyer flask equipped with 100ml LB medium, put 37 ° C, 180rpm shaker shaking culture, when the culture medium OD 600 When it reaches 0.6, add IPTG with a final concentration of 0.35mmol / l as an inducer, and after induction at 37°C for 5 hours, centrifuge the culture medium to collect the cells and wash them twice with physiological saline to obtain resting cells. Suspend the obtained quiescent cells in a pH 7.0 buffer, ultrasonically break in an ice bath, and centrifuge to collect the supernatant, which is the crude enzyme solution of the recombinant β-glucosidase. The crude enzyme solution was analyzed by polyacrylamide g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a new protein with beta-glucosidase activity. A coding nucleic acid of the protein comprises an expression vector of the nucleic acid and a transformant containing the nucleic acid or the expression vector. The invention also provides an application of the new protein as a catalyst in catalyzing a monosaccharide and alcohol to carry out counter hydrolysis reaction to form glucoside. Compared with the traditional beta-glucosidase in almonds, the beta-glucosidase provided by the invention has better thermal stability, and compared with the beta-glucosidase from many other microorganisms, the beta-glucosidase provided by the invention can endure glucoses with higher concentrations and has a good industrial application prospect in glucoside synthesis.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a new β-glucosidase and its gene, a recombinant expression vector and a recombinant expression transformant containing the gene, its recombinase and a preparation method of the recombinase, and the β-glucosidase. The application of glucosidase or its recombinant enzyme as a catalyst in the reverse hydrolysis synthesis of glycoside compounds. Background technique [0002] Glycoside is a general term for a class of compounds in which sugar groups and sugar-based ligands are covalently linked. Many glycoside compounds have special biological activities and are responsible for important physiological functions; some glycoside compounds, such as salidroside and arbutin, have specific medicinal value; and alkyl glucosides, as a new type of green non-ionic surface active It is widely used in detergents, food additives and other fields. Compared with chemical synthesi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/21C12P19/44C12R1/01
Inventor 郁惠蕾邹争争许建和李春秀潘江
Owner EAST CHINA UNIV OF SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More