Vitis bellula anthocyanidin reductase gene, protein coded by same and application of vitis bellula anthocyanidin reductase gene

A grape flower and reductase technology is applied in the fields of molecular biology, plant genetic engineering, and biology, and achieves good application prospects, improved crop resistance to diseases and insect pests, and improved forage varieties.

Inactive Publication Date: 2013-06-12
JISHOU UNIVERSITY
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Before the announcement of this invention, there was only a report on the anthocyanin reductase gene of European wine grape (Vitis vinifera), and there was no public or reported wild grape--Vitis bellula Anthocyanin reductase gene and its amino acid sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vitis bellula anthocyanidin reductase gene, protein coded by same and application of vitis bellula anthocyanidin reductase gene
  • Vitis bellula anthocyanidin reductase gene, protein coded by same and application of vitis bellula anthocyanidin reductase gene
  • Vitis bellula anthocyanidin reductase gene, protein coded by same and application of vitis bellula anthocyanidin reductase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, the synthesis of beautiful grape cDNA in South China

[0041] 1. Extraction and detection of total RNA from Meili grape in South China

[0042] Take 2 g of young leaves of Vitis bellula in South China, quickly grind them into powder with liquid nitrogen in a mortar, and quickly transfer them to 10 mL of extraction buffer preheated at 65 °C [CTAB (W / V) 2%, Tris-HCl (pH8.0) 100mmol / L, EDTA25mmol / L, NaCl2.0mol / L, PVP402%, spermidine 0.5g / L, mercaptoethanol 2%], shake and mix well; extract twice with equal volume of chloroform, Centrifuge at 7500g for 15min. Add 1 / 4 volume of 10M LiCl to the supernatant, mix and place at 4°C to precipitate overnight; centrifuge at 7500g for 20min, and use 500μL SSTE [SDS0.5%, NaCl1mol / L, Tris-HCl (pH8.0) 10mmol / L, EDTA1mmol / L], dissolved at 65°C for 5min. Extract with an equal volume of chloroform, centrifuge at 13,000g for 5min, add 2 times the volume of absolute ethanol to the supernatant, place at -70°C for 2h, centrifuge ...

Embodiment 2

[0045] Embodiment 2, the cloning of anthocyanin reductase gene

[0046] The nucleotide sequence and EST sequence related to the anthocyanin reductase gene were searched from NCBI, and a pair of amplification primers ANR-F (ATGGCCACCCAGCAC CCCAT) and ANR-R (TCAATTCTGCAATAGCCCCTTGGC) were designed using vector NTI software through comparison analysis. Using the cDNA of Huanan Meili grape as a template, follow the following system [10×Ex PCR buffer 5.0μL, dNTP (2.5mM) 4.0μL, primers LDC-F and LDC-R (10pmol) each 1.0μL, Ex Taq polymerase 0.25μL , cDNA4.0μL, add ddH 2 0 to a final volume of 50.0 μL] to amplify the LDC gene; reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 1 min, 30 cycles; final extension at 72°C for 10 min, and storage at 4°C. The amplification results were detected by 1% agarose gel electrophoresis ( figure 1 ). Utilize the Agarose Gel DNA Fragment Recovery Kit Ver.2.0 of TaK...

Embodiment 3

[0047] Embodiment 3, prokaryotic expression of anthocyanin reductase gene

[0048] 1. Construction of prokaryotic expression vector

[0049] Using the ANR in the T vector as a template, primer P1 (CATG CCATGG CCACCCAG CACCCCAT) and P2 (CCG CTCGAG TCAATTCTGCAATAGCCCCTTG) for PCR reaction, the amplified product was detected and purified by electrophoresis, digested with restriction endonucleases Nco I and Xho I at 37°C for 2 h, and the digested product was purified using a recovery kit (Takara Company, China); at the same time Use Nco I and Xho I to digest the pET-32a(+) vector at 37°C for 2 hours, and use the kit to recover the large fragment.

[0050] Mix the recovered two fragments, react at 16°C for 12 hours under the action of DNA ligase, and use CaCl to ligate the product 2 Transform Escherichia coli BL21(DE3) by using the method, carry out resistance screening on ampicillin and chloramphenicol resistance plates, and conduct whole-bacteria PCR detection on the clones,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vitis bellula anthocyanidin reductase gene, a protein coded by the vitis bellula anthocyanidin reductase gene and an application of the vitis bellula anthocyanidin reductase gene. The vitis bellula anthocyanidin reductase gene is initially obtained from the cDNA (complementarydeoxyribonucleic acid) and fills a blank on the molecular cloning of an anthocyanidin reductase gene for grape resources in China. The vitis bellula anthocyanidin reductase gene has a nucleotide sequence of SEQ ID NO. 1, and the protein coded by the vitis bellula anthocyanidin reductase gene has a nucleotide sequence of SEQ ID NO. 2. The vitis bellula anthocyanidin reductase gene can be used for increasing the content of active components such as proanthocyanidins in the vitis bellula by adopting a biotechnology, can be also used for improving the variety of forage grass, removing the puckery taste of agricultural products, breeding tea polyphenols molecularly and improving the pest and disease resistance of crops and has a good application prospect.

Description

technical field [0001] The invention belongs to the field of biotechnology, mainly relates to the acquisition of anthocyanin reductase gene and its encoded product by synthesizing cDNA of South China beautiful grape, PCR and recombinant expression technology, and belongs to the fields of molecular biology and plant genetic engineering. Background technique [0002] The formation of plant active ingredients (secondary metabolites) is the product of a unique group of genes in plant secondary metabolic pathways. With the extensive and in-depth study of plant functional genomes, the study of functional genes related to the secondary metabolism of economic crops has become one of the hotspots. The formation of quality provides a theoretical basis, and at the same time brings broad application prospects for the use of biotechnology for crop quality improvement, molecular genetic breeding and crop stress resistance. [0003] Proanthocyanidins (PA), also known as condensed tannins,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/63C12N1/21C12N1/19C12N5/10
Inventor彭清忠杜次朱越李菁
OwnerJISHOU UNIVERSITY