Gene for controlling early development of rice chloroplast and application of gene
A chloroplast and rice technology, which is applied in the field of basic research and achieves the effects of simple operation, improved purity and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1 Rice DNA Extraction
[0018] 1. Weigh 0.5g of fresh rice leaves at the seedling stage, cut the leaves into 0.5cm long pieces, put them in a pre-cooled mortar, add liquid nitrogen and grind them to powder, then transfer them to a 1.5ml centrifuge tube, add 1ml of 2×CTAB preheated at 60°C, shake gently and then bathe in water at 60°C for 45min, during which time shake twice.
[0019] 2. Take out the centrifuge tube, cool it at room temperature, centrifuge at 12,000 rpm for 5 minutes, absorb the supernatant, add an equal volume of chloroform-isoamyl alcohol (24:1) mixture, and mix well.
[0020] 3. Balance the centrifuge tube containing the solution, centrifuge at 12,000 rpm for 5 minutes, absorb the supernatant, add 2 / 3 volume of isopropanol, and mix gently to precipitate the nucleic acid.
[0021] 4. Centrifuge at 12,000 rpm for 5 min to precipitate the nucleic acid, discard the supernatant, wash with 70% ethanol, dry at room temperature, and dissolve in 10 μl...
Embodiment 2
[0023] Example 2 PCR amplification and gene detection
[0024] (1) Acquisition of genes controlling early rice chloroplast development
[0025] 1. The 25 μL PCR reaction system is as follows: 100mM Tris-HCl pH9.0; 100mM KCl; 20mM MgSO 4 ; 80mM (NH 4 ) 2 SO 4 ; 2.5 mM dNTP; 10 μM primer, 5U / μl Taq enzyme, 1 μl template DNA / 10 μl.
[0026] The primer sequences are:
[0027] F: 5'-AAA GGTACC GGCTTTGTGGAGAAGGAGAAATGTT -3' (underlined is the restriction endonuclease KpnI base recognition sequence)
[0028] R: 5'–AAAA CTGCAG TCACTAAAGGGAACAAAAAGCTGGTA-3' (underlined is the restriction endonuclease PstI base recognition sequence)
[0029] 3. The PCR amplification reaction is carried out on a PCR amplification instrument.
[0030] The temperature and reaction conditions are: 94°C pre-denaturation for 4min, 94°C denaturation for 30sec, 50°C annealing for 30sec, 72°C extension for 60sec, 35 cycles, and finally 72°C extension for 6min.
[0031] The length of the PCR amplifica...
Embodiment 3
[0045] Example 3 Gene function verification
[0046]The gene sequence of SEQ ID No.1 in rice is destroyed by mutagenesis by gamma rays or other physical methods. After the base deletion in the gene is sequenced, the RNA level decreases, and the early rice plants turn yellow. The result of the functional complementation experiment of this gene showed that the leaves of the offspring plants of the mutant containing the normal gene were green.
[0047] 1. Using SSR and InDel molecular markers to locate the mutant gene, through sequencing and semi-quantitative RT-PCR technology, it was shown that the gene sequence was mutated, and its RNA level expression decreased.
[0048] 3. Using Agrobacterium-mediated transgenic technology, the ORF nucleotide sequence of SEQ ID NO.1 was connected to the Agrobacterium expression vector pCAMBIA1301S containing the exogenous promoter CaMV35S, and the callus of the yellowing mutant was transformed to obtain The leaves of the positive first-gene...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
