Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene for controlling early development of rice chloroplast and application of gene

A chloroplast and rice technology, which is applied in the field of basic research and achieves the effects of simple operation, improved purity and low cost

Inactive Publication Date: 2013-11-27
SHANGHAI NORMAL UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this study, a rice seedling color mutant obtained through physical mutagenesis was used to locate a gene controlling chloroplast development by map-based cloning technology. So far, there has been no literature report related to this gene in rice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for controlling early development of rice chloroplast and application of gene
  • Gene for controlling early development of rice chloroplast and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 Rice DNA Extraction

[0018] 1. Weigh 0.5g of fresh rice leaves at the seedling stage, cut the leaves into 0.5cm long pieces, put them in a pre-cooled mortar, add liquid nitrogen and grind them to powder, then transfer them to a 1.5ml centrifuge tube, add 1ml of 2×CTAB preheated at 60°C, shake gently and then bathe in water at 60°C for 45min, during which time shake twice.

[0019] 2. Take out the centrifuge tube, cool it at room temperature, centrifuge at 12,000 rpm for 5 minutes, absorb the supernatant, add an equal volume of chloroform-isoamyl alcohol (24:1) mixture, and mix well.

[0020] 3. Balance the centrifuge tube containing the solution, centrifuge at 12,000 rpm for 5 minutes, absorb the supernatant, add 2 / 3 volume of isopropanol, and mix gently to precipitate the nucleic acid.

[0021] 4. Centrifuge at 12,000 rpm for 5 min to precipitate the nucleic acid, discard the supernatant, wash with 70% ethanol, dry at room temperature, and dissolve in 10 μl...

Embodiment 2

[0023] Example 2 PCR amplification and gene detection

[0024] (1) Acquisition of genes controlling early rice chloroplast development

[0025] 1. The 25 μL PCR reaction system is as follows: 100mM Tris-HCl pH9.0; 100mM KCl; 20mM MgSO 4 ; 80mM (NH 4 ) 2 SO 4 ; 2.5 mM dNTP; 10 μM primer, 5U / μl Taq enzyme, 1 μl template DNA / 10 μl.

[0026] The primer sequences are:

[0027] F: 5'-AAA GGTACC GGCTTTGTGGAGAAGGAGAAATGTT -3' (underlined is the restriction endonuclease KpnI base recognition sequence)

[0028] R: 5'–AAAA CTGCAG TCACTAAAGGGAACAAAAAGCTGGTA-3' (underlined is the restriction endonuclease PstI base recognition sequence)

[0029] 3. The PCR amplification reaction is carried out on a PCR amplification instrument.

[0030] The temperature and reaction conditions are: 94°C pre-denaturation for 4min, 94°C denaturation for 30sec, 50°C annealing for 30sec, 72°C extension for 60sec, 35 cycles, and finally 72°C extension for 6min.

[0031] The length of the PCR amplifica...

Embodiment 3

[0045] Example 3 Gene function verification

[0046]The gene sequence of SEQ ID No.1 in rice is destroyed by mutagenesis by gamma rays or other physical methods. After the base deletion in the gene is sequenced, the RNA level decreases, and the early rice plants turn yellow. The result of the functional complementation experiment of this gene showed that the leaves of the offspring plants of the mutant containing the normal gene were green.

[0047] 1. Using SSR and InDel molecular markers to locate the mutant gene, through sequencing and semi-quantitative RT-PCR technology, it was shown that the gene sequence was mutated, and its RNA level expression decreased.

[0048] 3. Using Agrobacterium-mediated transgenic technology, the ORF nucleotide sequence of SEQ ID NO.1 was connected to the Agrobacterium expression vector pCAMBIA1301S containing the exogenous promoter CaMV35S, and the callus of the yellowing mutant was transformed to obtain The leaves of the positive first-gene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene for controlling early development of rice chloroplast and a detection method and an application of the gene. The invention discloses a gene for controlling early development of rice chloroplast, wherein the gene has a nucleotide sequence as shown in SEQIDNo.1, and protein encoded by the gene has an amino acid sequence as shown in SEQIDNo.2. By utilizing designed specific PCR (Polymerase Chain Reaction) primers as shown in SEQIDNo.4 and No.5, rice plants containing the gene can be quickly detected after PCR amplification and ScaI enzyme digestion for appraisal are carried out on DNA (Deoxyribose Nucleic Acid) extracted from rice, and the detection method is high in detection accuracy, easy to operate and low in cost. Early rice plant yellowing can be caused when the gene in rice is damaged. The gene for controlling early development of rice chloroplast obtained by the invention can be applied to hybrid rice seed production, and the purity of a hybrid rice sterile line and the hybrid rice hybridized by the hybrid rice sterile line can be improved.

Description

technical field [0001] The invention relates to the fields of agriculture and plant biotechnology, especially the basic research on plant genetics and breeding, plant physiology and gene function at the molecular level. Background technique [0002] Chloroplast is the place where higher plants carry out photosynthesis, and the development of chloroplast is controlled by a series of nucleoplasmic genes. Studies have shown that the destruction of the genes controlling chloroplast development can lead to the obstruction of chloroplast development, which will lead to abnormal leaf color and even a sharp decline in photosynthetic efficiency. At present, researchers use physical, chemical, and biological mutagenesis to obtain rice leaf color mutants, and apply them to rice genetic breeding, physiology, and cloning and functional research of related genes. In this study, a rice seedling color mutant obtained through physical mutagenesis was used to locate a gene controlling chloro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/11C12Q1/68C07K14/415
Inventor 江泉陈平梅杰林冬枝董彦军
Owner SHANGHAI NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com