Hemoglobin gene of macrobrachium nipponensis, cloning method of hemoglobin gene, and preparation method of recombinant protein

A technology of hemoglobin and Macrobrachium, applied in the direction of hemoglobin/myoglobin, genetic engineering, DNA preparation, etc., can solve problems such as poor management of artificial breeding, disease outbreaks of Macrobrachium japonica, few reports of crustacean hemoglobin, etc., and achieve strong antibacterial The effect of action

Inactive Publication Date: 2014-10-01
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the influence of temperature, circadian rhythm and seasonal changes, as well as eutrophication, coupled with poor management of artificial breeding, it is easy to cause disease outbreaks and even mass mortality of Macrobrachium japonicus; (Undigested feed and excreta) decay and decompose, and the bottom mud releases a large number of pathogenic bacteria, resulting in the long-term physiological stress of Macrobrachium japonicus with benthic habits. Therefore, it is the current research to find effective immune enhancers to enhance the immune function of crustaceans. hot issues
So far, not only the research on the hemoglobin of Macrobrachium japonicus is still blank, but also the role of crustacean hemoglobin in its immune response is rarely reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hemoglobin gene of macrobrachium nipponensis, cloning method of hemoglobin gene, and preparation method of recombinant protein
  • Hemoglobin gene of macrobrachium nipponensis, cloning method of hemoglobin gene, and preparation method of recombinant protein
  • Hemoglobin gene of macrobrachium nipponensis, cloning method of hemoglobin gene, and preparation method of recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Cloning of full-length cDNA sequence of hemoglobin

[0027] 1) Put 10 Macrobrachium japonicus into a glass-steel bucket, and extract RNA from the gill tissue of the shrimp. The test system includes a plastic water tank (50cm×40cm×30cm), air pump, nitrogen tank, etc. The dissolved oxygen content of the test treatment group was mainly adjusted by aeration (adjusting the ratio of air and nitrogen) to adjust the oxygen content in the water body to 2mg / L, and the air aeration group was used as the control group. During the test, the Macrobrachium japonicus temporarily kept in the water body with a dissolved oxygen content of 6.5 mg / L was moved to the water tanks with low dissolved oxygen respectively, and 20 healthy Macrobrachium japonicus in the intermolting period were stocked in each tank, and each gradient was set to Three parallel control groups were used to monitor the change of dissolved oxygen content in the water tank with a YSI-556MPS dissolved oxygen meter every 2...

Embodiment 2

[0058] Bioinformatics Analysis:

[0059] According to the obtained full-length cDNA sequence of Macrobrachium japonicus hemoglobin, using BLAST software comparison on http: / / www.ncbi.nlm.nih.gov / , it is determined that the ORF is 579bp in total, encoding 193 amino acids, see SEQ ID NO. 1. The hemoglobin gene family contains 8 conserved amino acid residue sites, the sequence of which is: Trp Phe Pro His Thr Val His Trp (SEQ ID NO.3). The conserved sequence MGXXSX (grey part) necessary for N-myristoylation in Macrobrachium japonicus hemoglobin has been found by bioinformatics methods, and N-myristoylation protein is formed on the N-terminal glycine to enhance its lipophilicity (arrows shown), confirming that hemoglobin is a cell membrane-bound protein, such as figure 2 shown. Among them, the cDNA of the hemoglobin gene is 1,201 bp in full length, has an open reading frame of 579 bp, encodes 193 amino acids, has a 5' non-coding region of 199 bp, and a 3' non-coding region of ...

Embodiment 3

[0061] Fluorescent quantitative PCR analysis:

[0062] The present invention verifies that Macrobrachium japonicus hemoglobin participates in the molecular process of hypoxic stress, image 3 It indicated that the hemoglobin of Macrobrachium japonicus was significantly increased under hypoxic stress. In this example, the detection method of hemoglobin fluorescent quantitative PCR will be introduced.

[0063] Fluorescent quantitative PCR (qRT-PCR) is an electrophoretic analysis method that uses the characteristics of a highly sensitive DNA fluorescent dye—SYBR Green 1 combined with dsDNA to release a fluorescent signal to indicate the amount of the target gene amplification product. For Macrobrachium japonicus hemoglobin gene and β-actin gene, using the reverse transcription solution as a template, use qRT-PCR-F: 5'GGTCTTCAAAGGTTGGAGCA3'(SEQ ID NO.6); qRT-PCR-R: 5'GTTCGGTGCCTTAGAGTGAG3'( SEQ ID NO.7) to amplify these two genes, the reaction system is as follows:

[0064] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses hemoglobin gene of macrobrachium nipponensis, a clone method of the hemoglobin gene, and a preparation method of recombinant protein. The hemoglobin gene of macrobrachium nipponensis is cloned through an expressed sequence tag technology and 3'and 5' rapid amplification cDNA end (RACE), wherein the overall length of the cDNA is 1201bp, the gene has a 579bp open reading frame and encodes 193 amino acids, 5' noncoding region is 199bp and 3' noncoding region is 420bp, and the gene has polyadenylic acid tailing signal and polyadenylic acid tail. The gene plays an important role in immune defense of macrobrachium nipponensis. The hemoglobin gene of macrobrachium nipponensis is obtained by in vitro recombination expression; the recombinant protein not only can carry oxygen, but also has bacteriostasis, thereby providing theoretical basis for disease control and gene-assisted breeding of macrobrachium nipponensis,and development of feed additives for macrobrachium nipponensis.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to the hemoglobin gene sequence of Macrobrachium japonicus. The hemoglobin gene sequence is screened in the Macrobrachium japonicus transcriptome library constructed by means of RNA-seq high-throughput sequencing, and the full cDNA sequence of hemoglobin is obtained by using RACE PCE technology. , and carried out prokaryotic recombinant expression, and also analyzed that the gene expression product has antibacterial effect. Background technique [0002] The respiratory proteins of animals are usually divided into three categories: Hemoglobin (Hb), Hemocyanin (Hc) and Earthworm hemoglobin (Hemerythreins, Hr) (Terwilliger, 1998). Among them, hemoglobin is the most widely distributed, not only in vertebrates, but also in invertebrate crustaceans. In view of the fact that hemoglobin is involved in oxygen sensing and transport in higher animals, it has been a research hotspot to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C07K14/805C12N15/10A61K38/42A23K1/16A61P31/04A23K20/147A23K50/80
Inventor孙盛明戈贤平傅洪拓朱健
OwnerFRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI