Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

3-hydroxy-3-methylglutaryl-CoA reductase and coding gene and application of 3-hydroxy-3-methylglutaryl-CoA reductase

A methylglutaryl coenzyme and reductase technology, applied in the field of genetic engineering, can solve problems such as no cloning, and achieve the effect of improving disease resistance and stress resistance

Active Publication Date: 2015-12-09
TONGDE HOSPITAL OF ZHEJIANG PROVINCE
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Grifola frondosa is a fungus that is both edible and medicinal. It belongs to the order Aphylloides, Polyporaceae, and Tree Flower. It contains a variety of functional components, such as polysaccharides, terpenes, amino acids, etc., and has good anti-cancer, anti-cancer, Anti-aging, anti-virus and other functions, at present, 3-hydroxy-3-methylglutaryl-CoA reductase gene has been cloned from Arabidopsis thaliana, tobacco, pepper, andrographis paniculata, ginseng, Dendrobium officinale, and Ganoderma lucidum, but not See report on cloning 3-hydroxy-3-methylglutaryl-CoA reductase gene from Grifola frondosa as material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 3-hydroxy-3-methylglutaryl-CoA reductase and coding gene and application of 3-hydroxy-3-methylglutaryl-CoA reductase
  • 3-hydroxy-3-methylglutaryl-CoA reductase and coding gene and application of 3-hydroxy-3-methylglutaryl-CoA reductase
  • 3-hydroxy-3-methylglutaryl-CoA reductase and coding gene and application of 3-hydroxy-3-methylglutaryl-CoA reductase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The extraction of embodiment 1 Grifola frondosa total RNA

[0029] The extraction steps are as follows:

[0030] (1) Cracking of the sample: take 50-100 mg of Grifola frondosa fruiting body and put it in a mortar, add liquid nitrogen to quickly grind it into powder, transfer it into a centrifuge tube that has added 1 ml Trizol, and blow and mix with a pipette;

[0031] (2) Stand at room temperature for 5 minutes, centrifuge at 12,000 rpm for 10 minutes at 4°C;

[0032] (3) Transfer the supernatant to another centrifuge tube, add 200 μL of chloroform, mix by inversion, place at room temperature for 10 min, and centrifuge at 12000 rpm for 15 min at 4 °C;

[0033] (4) Transfer the upper aqueous phase, move it to another centrifuge tube, add an equal volume of isopropanol, mix well, and place at room temperature for 5-10 minutes;

[0034] (5) Centrifuge at 12000rpm for 10min at 4°C, discard the supernatant;

[0035] (6) Add 500 μL of 75% ethanol, mix for a while, centrif...

Embodiment 2

[0037] Cloning of the 3-hydroxyl-3-methylglutaryl-CoA reductase gene (Gfhg) of Example 2 Grifola frondosa

[0038] Take 1 μg of total RNA, use randomhexamers as primers, follow the instructions of SuperScriptIII First-StrandSynthesisSystem, and reverse transcribe to generate the first strand.

[0039] Primers were designed according to the CDS sequence of Grifola frondosa 3-hydroxy-3-methylglutaryl-CoA reductase gene as follows:

[0040] Upstream primer SEQ ID NO.1Gfhg-F: gaagatctatgcgtgcgatacttcgcccgc;

[0041] Downstream primer SEQ ID NO.2Gfhg-R: cccacgtgtcacttcgtctccacagcatagc;

[0042] The first-strand cDNA generated by reverse transcription of the total RNA of Grifola frondosa was used as a template for PCR amplification.

[0043] The PCR reaction system is as follows:

[0044]

[0045] The PCR amplification procedure is as follows:

[0046]

[0047] Refer to the instructions of QuickGelExtraction Kit (Kangwei Century) to perform gel extraction and recovery of t...

Embodiment 3

[0048] Construction of embodiment 3 cloning vector pGEM-T-Gfhg

[0049] Referring to pGEM-TVectorSystems (Promega), T4DNALigase in the kit was used to connect the Gfhg gene fragment (SEQ ID NO.5) recovered from gel cutting to the T vector.

[0050]Referring to the instructions of pGEM-TVectorSystems (Promega), the ligation product was transformed into DH5α Escherichia coli competent cells. Add 400 μL LB liquid medium to the transformation product, culture at 37°C for 2 hours on a shaker at 200 rpm, spread evenly on the LB solid culture dish containing X-Gal, IPTG, and AMP, place it upright for 1 hour to dry, and culture it upside down at 37°C for 28 -24h to form a single colony.

[0051] Use the above primers Gfhg-F and Gfhg-R to identify 10 single clones by PCR. PCR conditions: 93°C, 3min; 93°C, 30s; 56°C, 30s; 72°C, 3min, 30 cycles; 72°C, 10min . PCR product electrophoresis verification, select the clone with the correct electrophoresis band and send it to Shanghai Sangon...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 3-hydroxy-3-methylglutaryl-CoA reductase and a coding gene and application of the 3-hydroxy-3-methylglutaryl-CoA reductase. An amino acid sequence of the 3-hydroxy-3-methylglutaryl-CoA reductase is shown as SEQ ID NO.6. A complete 3669bp gene sequence is obtained by that total RNA (ribose nucleic acid) of grifola frondosa sporophores is extracted and synthesized into cDNA (complementary deoxyribonucleic acid) by reverse transcription and a 3-hydroxy-3-methylglutaryl-CoA reductase gene (Gfhg) is cloned according to RT-PCR (reverse transcription-polymerase chain reaction) technologies. A eukaryotic expression vector pCAMBIA1302-Gfhg-hyg is constructed, and functional verification of pCAMBIA1302-Gfhg-hyg obtained by cloning is realized by application of an antrodia cinnamomea mycelium system. By the 3-hydroxy-3-methylglutaryl-CoA reductase gene (Gfhg) of grifola frondosa, content of antrodia cinnamomea triterpenes in antrodia cinnamomea sporophores and secondary metabolites can be increased, and content of triterpenes generated by plants is increased so as to improve disease resistance of the plants.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a 3-hydroxy-3-methylglutaryl coenzyme A reductase and its coding gene and application. Background technique [0002] There are two biosynthetic pathways of plant terpenes: mevalonic acid pathway (mevalonic pathway, MVA) and deoxyxylose phosphate pathway (1-deoxy-D-xylulose-5-phosphate pathway, DXP) . The MVA pathway is located in the cytoplasm and endoplasmic reticulum, and terpenoids are mainly synthesized in the cytoplasm through the MVA pathway. 3-hydroxy-3-methylglutaryl-CoA reductase (3-hydroxy-3-methylglutaryl-CoAreductase, HMGR) catalyzes HMG-CoA to form mevalonate (MVA), which is an irreversible process, so 3-hydroxy-3-methylglutaryl-CoA reductase is considered to be the rate-limiting enzyme in the MVA pathway. [0003] Terpenoids are widely found in higher animals, plants and eukaryotes. It is a general term for natural organic compounds composed of thirty carbons ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/04C12N15/53C12P1/02C12P1/04
CPCC12N9/0006C12P1/02C12P1/04C12Y101/01034C12N1/145C12N1/205C12R2001/01C12R2001/19C12R2001/645
Inventor 陈观平应栩华汪一帆王刚李明乾蒋立文
Owner TONGDE HOSPITAL OF ZHEJIANG PROVINCE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com