Method for producing D-ribose at high yield by using bacillus subtilis engineering bacterium

A Bacillus subtilis, engineering bacteria technology, applied in the field of bioengineering, can solve the problems of large infection risk, poor tolerance, slow growth, etc.

Active Publication Date: 2017-05-10
SHANDONG FOOD & FERMENT IND RES & DESIGN INST
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In view of the above-mentioned problems existing in the prior art, especially for the problems that the strain SFR-4 has poor environmental tolerance, slow growth, and high risk of bacterial infection in the industrial production process, the present invention provides a strain with strong stress resistance , D-ribose-fermenting Bacillus subtilis engineering bacteria that grow vigorously and are not easy to infect bacteria. The present invention is based on the problem of poor stress resistance of transketolase-deficient D-ribose high-yielding Bacillus subtilis obtained by conventional mutation breeding. Through molecular Obtain a D-ribose production strain with good stress resistance and fast sugar consumption by biological means. Further, through the control of fermentation process and the change of metabolic regulation conditions, the metabolic flow of the strain itself is regulated, making the strain more inclined to fermentation production D-ribose, which can significantly increase the production and yield of D-ribose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing D-ribose at high yield by using bacillus subtilis engineering bacterium
  • Method for producing D-ribose at high yield by using bacillus subtilis engineering bacterium
  • Method for producing D-ribose at high yield by using bacillus subtilis engineering bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 strain SFR-43T construction

[0059] (1) Using the strain SFR-4 genome as a template, amplify the 500 bp fragment (including the mutation site) before the stop codon of the transketolase gene of the strain, called L-tkt (its sequence is shown in SEQ ID NO.10) . Its downstream primer contains the front 25bp complementary sequence of lox71-zeo-lox66.

[0060] Template: strain SFR-4 genome

[0061] Upstream primer: GCAGCATGGAAGCTTGCAG (SEQ ID NO.1)

[0062] Downstream primer: TATAATGTATGCTATACGAACGGTATTATCTTGATACTATAG AAACATCTCAAGG (SEQ ID NO.2)

[0063] PCR reaction system (50uL): strain SFR-4 genomic DNA template 1uL, upstream primer 1uL, downstream primer 1uL, 2*Buffer 25uL, dNTP 4uL, high-fidelity PCR enzyme PrimeSTAR 0.5uL, sterile water 17.5uL.

[0064] PCR reaction conditions: denaturation at 95°C for 5min, 10s at 98°C, 30s at 60.3°C, 30s at 72°C, 33 cycles.

[0065] The amplified products were detected and collected by 1% agarose gel electrophoresis....

Embodiment 2

[0095] Embodiment 2 bacterial strain SFR-43T product analysis

[0096] Take the fresh slant of the strain SFR-43T cultured at 37°C for 2 days, use an inoculation loop to take 1-2 loops of the slant strain, inoculate it into the liquid seed medium, cultivate it on a shaker at 37°C for 14 hours at 180rpm, and inoculate 5% of the inoculum. Into the fermentation medium, 37 ° C, 180 rpm shake flask culture for 72 hours. The fermentation broth was centrifuged at 4500rpm for 10min, and the supernatant was taken for product analysis. The results showed that 3-hydroxybutanone and D-ribose components were detected simultaneously in the fermentation broth of the strain SFR-43T.

[0097] Fermentation medium (g / L): glucose 150g / L, yeast extract 5g / L, corn steep liquor 10g / L, (NH 4 ) 2 SO 4 2.5g / L, MgSO 4 2g / L, MnSO 4 0.2g / L, pH6.5.

Embodiment 3

[0098] Embodiment 3 fermentation medium optimization

[0099] Based on the strain SFR-4D-ribose fermentation medium, the present invention further optimizes the nitrogen source and other components of the culture medium for the fermentation of D-ribose by the strain SFR-43T.

[0100] Nitrogen source optimization: take fresh slant of the strain SFR-43T cultivated at 37°C for 2 days, pick 1-2 rings with an inoculation loop, inoculate into liquid seed medium, culture at 37°C, 180rpm shaker for 14 hours, inoculum amount 5% , inoculated into shake flask fermentation media containing different nitrogen sources (the nitrogen sources were respectively peptone, yeast extract, corn steep liquor dry powder, ammonium nitrate, diammonium hydrogen phosphate, ammonium sulfate, the concentration was 10g / L, and the carbon source was Glucose, the other components are the same), 37 ° C, 180 rpm shake flask culture for 72 hours. The fermentation broth was centrifuged to remove bacteria, and the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing D-ribose at high yield by using bacillus subtilis engineering bacteria. On the basis of high homology between a D-ribose production strain SFR-4 and a strain SFA-H43 genome, a strain SFR-4 transketolase gene mutation sequence is transferred into a wild strain SFA-43 by a homologous recombination method, and a strain transketolase gene is substituted to obtain an engineering strain SFR-43T having a transketolase variation sequence; the engineering strain SFR-43T keeps superior fermentation performance (high stress resistance and high glucose consumption rate) of the strain SFA-43, and can accumulate the D-ribose at the same time. The initial sugar concentration is controlled, and a glucolactone feeding technology is adopted in a fermentation process, so that the yield and conversion rate of the engineering strain D-ribose can be increased greatly, and accumulation of 3-acetoin is controlled.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, relates to the breeding of industrial microorganisms and the microbial fermentation preparation of industrial products, in particular to a method for high-yielding D-ribose by using Bacillus subtilis engineering bacteria. Background technique [0002] D-ribose is a five-carbon sugar, which is an important part of life genetic material ribonucleic acid and physiologically active substances ATP, NADH, NADPH, and FADH. It is a major participant in energy metabolism in organisms and has important physiological functions. [0003] D-ribose is mainly used in industry for riboflavin vitamin B 2 As well as the production of food flavoring agents, in recent years, more studies have used D-ribose as a pharmaceutical intermediate for the synthesis of antiviral and anti-tumor drugs. In addition, D-ribose can also be used as an auxiliary drug for the treatment of Myocardial ischemia, muscle stiffness ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/02C12P7/26C12N1/21C12R1/125
CPCC12N9/1022C12P7/26C12P19/02C12Y202/01001
Inventor张家祥赵祥颖刘建军赵晨韩延雷乔君杨丽萍
OwnerSHANDONG FOOD & FERMENT IND RES & DESIGN INST