Recombinant saccharomycetes with soybean hull peroxidases displayed on cell surfaces as well as construction method and application of recombinant saccharomycetes

A technology of bean shell peroxide and bean shell peroxidase, which is applied in the field of genetic engineering, can solve the problems of low host cells, difficulty in purification of secreted and expressed ShP, and complicated separation and purification process of natural ShP, so as to overcome the cumbersome separation and purification operation. Effect

Active Publication Date: 2018-05-29
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the problems in the prior art that the separation and purification process of natural ShP is complex, the intracellular expression of recombinant ShP has no activity or low activity, toxicity to host cells, and difficulty in purification of secreted and expressed ShP, the present invention provides a cell surface displaying soy husk super The recombinant yeast of oxidase and its construction method and application specifically provide a genetically engineered Yarrowialipolytica (Yarrowialipolytica) that integrates a sequence-optimized ShP gene into the chromosome and displays ShP on the cell surface, and utilizes the engineering Bacterial fermentation produces recombinant ShP immobilized on the cell surface, and the technical scheme adopted is as follows:

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant saccharomycetes with soybean hull peroxidases displayed on cell surfaces as well as construction method and application of recombinant saccharomycetes
  • Recombinant saccharomycetes with soybean hull peroxidases displayed on cell surfaces as well as construction method and application of recombinant saccharomycetes
  • Recombinant saccharomycetes with soybean hull peroxidases displayed on cell surfaces as well as construction method and application of recombinant saccharomycetes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Soybean shell peroxidase surface display plasmid construction, the steps are as follows:

[0052] Design the nucleotide sequence shown in SEQ ID No.1, and send it to a third-party company to synthesize and clone it into the pUC57-simple vector to obtain the pUC57S-oEp plasmid (plasmid map as shown in figure 2 shown), after being digested with SfiI / BamHI restriction endonuclease, the target fragment was recovered and connected to the pMIZY05v2 expression vector digested with the same enzyme (plasmid map as shown in figure 1 shown) above.

[0053] SEQ ID NO.1 (the underlined parts are SfiI and BamHI restriction enzyme sites respectively):

[0054] GT GGCCGTTCTGGCCCAGCTGACCCCCACCTTCTACCGAGAGACCTGTCCCAACCTGTTCCCCATCGTGTTCGGCGTCATTTTCGACGCCTCTTTCACCGACCCCCGAATCGGAGCTTCCCTGATGCGACTGCACTTCCACGACTGTTTCGTGCAGGGTTGCGACGGCTCTGTCCTGCTGAACAACACCGACACCATCGAGTCTGAGCAGGACGCCCTGCCCAACATCAACTCCATTCGAGGACTGGACGTGGTCAACGACATTAAGACCGCTGTGGAGAACTCTTGTCCCGACACCGTCTCCTGCGCCGACATCCTGGCTATTG...

Embodiment 2

[0073] Obtaining of recombinant strains, the steps are as follows:

[0074] (1) Preparation of recombinant fragments The pMIZY05v2-oEp recombinant plasmid was digested with NotI restriction endonuclease and detected by agarose gel electrophoresis. After digestion of pMIZY05v2-oEp, two fragments are expected to appear, the sizes are 4.5kbp and 2.7kbp respectively. Recombinant vector NotI digestion and electrophoresis results are as follows: image 3 As shown, the two fragments are consistent with expectations. Recycle large fragments, spare

[0075] (2) Yeast Competent Cell Preparation Inoculate the Yarrowia lipolytica PO1h strain on YPD solid medium and culture overnight at 28°C; pick a single colony and inoculate it in 5.0mL liquid YPD medium, and culture overnight at 28°C with shaking ; at a final concentration of 5.0×10 6 cells / mL were inoculated in 50.0 mL liquid YPD medium, cultured with shaking at 200 rpm for 4 h at 28 °C; centrifuged at 1500 × g for 5 min at 4 °C to...

Embodiment 3

[0079] To verify the ability of recombinant strains to produce immobilized enzymes, the steps are as follows:

[0080] (1) Pick a single colony of recombinant yeast and inoculate it in 5.0 mL of YPD liquid medium, culture it with shaking at 28°C overnight, and this is the seed solution.

[0081] (2) Take 1.0 mL of seed liquid, transfer it to 50.0 mL of PPB medium, culture it with shaking at 25°C for 3-5 days, and the obtained fermentation liquid is the crude enzyme liquid.

[0082] (3) The activity of ShP in the crude enzyme solution was detected by ABTS method, the darker the color, the higher the activity, and thus the strains with high activity were screened. For the darker color, determine the specific value of ShP activity, and the reaction solution system is as follows:

[0083]

[0084] Incubate at 35°C and pH 6.0 for 5 minutes, and the color changes after the reaction is as follows: Figure 4 shown (green). Measure the change of the 420nm absorbance value of the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides recombinant saccharomycetes with soybean hull peroxidases displayed on cell surfaces as well as a construction method and an application of the recombinant saccharomycetes and belongs to the technical field of genetic engineering. A nucleotide sequence shown as SEQ ID No.1 is designed, the sequence is linked to a pUC57-simple vector after chemical synthesis and then is subcloned to a pMIZY05v2 expression vector, a recombinant vector pMIZY05v2-oEp is constructed and transformed into Yarrowia lipolytica PO1h strains after linearization, and engineering bacteria capable ofdisplaying recombinant soybean hull peroxidases on the surfaces are obtained; the engineering bacteria are cultured for 2-5 d in a PPB culture medium containing heme, cells are collected centrifugally, and immobilized recombinant soybean hull peroxidases are obtained. The recombinant soybean hull peroxidases can be obtained by simple centrifugal collection of bacteria, tedious separation and purification steps of peroxidases can be omitted, production technology is simplified, and production cost is reduced.

Description

technical field [0001] The invention relates to a recombinant yeast with bean hull peroxidase displayed on the cell surface and its construction method and application, belonging to the technical field of genetic engineering. Background technique [0002] Peroxidase (peroxidase, EC 1.11.1.x) is a class of oxidoreductase widely present in animals, plants and microorganisms, usually composed of a peptide chain and heme prosthetic group (some species also contain Ca 2+ , Mn 2+ and other metal ions), can be H 2 o 2 Or organic peroxides are electron acceptors that catalyze the oxidation reactions of various substrates. Soybean hull peroxidase (ShP, EC 1.11.1.7) is a peroxidase extracted from soybean (Glycine max) bean hull, which belongs to class III of plant peroxidase superfamily (secreted peroxidase), capable of H 2 o 2 Catalyzes the oxidation of a wide variety of organic and inorganic substrates for electron acceptors. Natural ShP has a molecular weight of about 40kDa,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N1/19C12N15/53C12N9/08C12N11/02C12R1/645
CPCC12N9/0065C12N11/02C12N15/815C12Y111/01
Inventor咸漠王纪明张海波王帆刘会洲
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI