Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of maize ms30 gene mutant and its molecular identification method and application

A MS30, corn technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of economic loss, increased cost, incompleteness, etc., and achieve the effect of huge economic value

Active Publication Date: 2020-01-24
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Artificial detasseling is relatively easy, and mechanical detasseling and chemical detasseling can also be used. However, these strategies also have some problems: on the one hand, these techniques greatly increase the cost of seed production; Thorough or untimely, it will reduce the purity of hybrids, resulting in a large area of ​​production reduction, and ultimately lead to great economic losses
The mutant is caused by the insertion or deletion of four nucleotides in the MS30 gene; the MS30 gene has three exons and two introns, encoding a 408 amino acid protein, which contains a GDSL-Lipase domain, Studies have shown that GDSL-Lipase protein plays an important role in the development of plant floral organs and morphogenesis; in MS30 mutant plants, the microspore cell wall develops slowly in the early vacuolar microspore stage, and the germination hole appears abnormal. Large vacuole formation accompanied by cytoplasmic degradation leading to loss of mutant motility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of maize ms30 gene mutant and its molecular identification method and application
  • A kind of maize ms30 gene mutant and its molecular identification method and application
  • A kind of maize ms30 gene mutant and its molecular identification method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0041] Example 2 M 2 Substitute Planting and Character Observation

[0042] m 1 The generation plants selfed to produce seeds, and planted M 2 Generation, in M 2 During the earing and flowering periods of the generation, the morphology of the anthers was observed in the field, and a microscope was selected for inspection. In the family numbered 4898, a plant with abnormal fertility was found. The mutant had no obvious difference from the wild type in terms of vegetative growth, heading stage, and panicle type. figure 1 The pollen iodine staining pattern of the mutant plant (Panel A) and the iodine staining pattern of the mutant male pollen (Panel B) and the comparison photos of the mutant anther (Panel C left) and the wild type anther (Panel C right). The male anthers of the mutant were significantly smaller and whiter, and the pollen grains of the mutant were small, irregular, and uncolored by iodine staining, while the pollen grains of the wild type Jingkenuo 2000 were l...

Embodiment 3

[0043] Example 3 Microscopic examination of pollen, selfing and outcrossing

[0044] The pollen fertility was counted by the ratio of iodine-stained pollen to non-colored pollen. Observing the male flower morphology of the 4898 mutant under a stereomicroscope, the anthers were smaller and lighter in color than the wild type (see figure 1 Figure C). Collect florets at the flowering stage in the field, take out the anthers with tweezers, gently squeeze the anthers in an iodine-potassium iodide solution (0.6% KI, 0.3% I2, w / w), drop them on a glass slide, cover with a cover glass, and place them under the microscope Observe the iodine staining of pollen and take pictures. The wild type has more pollen and is dyed blue-black, while the pollen grains of the mutant are small and cannot be dyed ( figure 1 Figures A and B). The mutant can bear fruit normally under open pollination, indicating that the mutant is a male sterile mutant and females are not affected. Bagging selfing w...

Embodiment 4

[0045] Example 4 Leaf Sampling and DNA Extraction

[0046] Use the CTAB method to extract DNA from rice leaves. The specific method is as follows: Weigh about 0.1g leaves, put them into a centrifuge tube, add 600 μL CTAB extraction buffer, 5 μL RNase A, oscillate to disperse, and place in a water bath at 65°C for 0.5 hr, shaking gently for 2-3 hours. Add an equal volume of chloroform / Tris-saturated phenol (1:1, v / v), mix well, and shake gently for 10 minutes; centrifuge at 10,000 rpm at 4°C for 20 minutes; transfer the supernatant to a new tube, and add 1 / 10 volume of 3M sodium acetate (pH value 5.2), 0.6-1 times the volume of cold isopropanol; gently shake and mix until flocculent precipitate appears; centrifuge at 10,000 rpm at 4°C for 10 min; discard the supernatant, and wash the precipitate with 70% ethanol by volume 2 time; air-dry, add 50 μL 1×TE to dissolve the precipitate, and store at -20°C. The DNA concentration was detected by Nanodrop2000 and diluted to 10ng / L for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides corn MS30 gene mutant, and applications thereof, and belongs to the technical field of gene engineering. According to a preparation method, hybrid corn variety Jingkenuo 200 issubjected to cobalt60 radiation induced mutation to realize replacement of 408 bases from 199th to 607th site of a first exon on corn MS30 gene coding region by AGTCTCGGTACTACTACGCCCAGTCTC, the MS30 gene mutant is named as ms30-4898, and the nucleotide sequence is represented by SEQ ID No.2. It is confirmed that the corn MS30 gene mutant is capable of inducing corn recessive genic male sterility,can be used for preparing transgenic corn with recessive genic male sterility, and important effect in corn genetic resource genetic improvement breeding is achieved. The invention also provides a molecular marker identification method of the corn MS30 gene mutant, and applications of the corn MS30 gene mutant in breeding seed production.

Description

technical field [0001] The invention belongs to the field of plant molecular biology, and in particular relates to a maize MS30 gene mutant ms30-4898 and its molecular identification method and application. Background technique [0002] Plant male sterile mutation is a very common phenomenon in nature, at least male sterile mutants have been found in 617 species of 43 families and 162 genera. Genetically, plant male sterility is divided into three categories: nuclear male sterility, cytoplasmic male sterility and nuclear-cytoplasmic interaction male sterility: 1) Nuclear male sterility is produced by nuclear gene mutations, and there are dominant mutations and recessive mutations , There are sporophytic gene mutations and gametophytic gene mutations. Dominant mutations and gametophytic gene mutations can only be inherited through female gametes, recessive mutations can be inherited through both female gametes and male gametes, and follow Mendel's laws. Some sporophytic rec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/20C12N15/55C12N15/82C12N15/11A01H5/00A01H6/46C12Q1/6895
CPCC12N9/20C12N15/8289C12Q1/6895C12Q2600/156
Inventor 黄培劲龙湍李京琳李新鹏王明志曾翔吴永忠
Owner HAINAN BOLIAN RICE GENE TECH CO LTD