Novel multicopper oxidase and application thereof to biogenic amine degradation

A technology of multi-copper oxidase and biogenic amine, which is applied in the field of molecular biology, can solve the problems of few degradation types and poor degradation effect, and achieve the effect of strong degradation of biogenic amine, improved safety, and obvious degradation effect

Inactive Publication Date: 2019-03-15
JIANGNAN UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

3. Terminal elimination: By adding biogenic amine degrading enzymes to fermented food, it does not damage food nutrition and does not produce new toxic substances. The limitation is that the existing biogenic amine degrading enzymes have poor degradation effects, few types of degradation, and the optimum pH is moderate Not suitable for acidic fermented food such as soy sauce
In the prior art, no multi-copper oxidase that has the effect of degrading biogenic amines in an environment of about pH 4.5 and 18% NaCl has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel multicopper oxidase and application thereof to biogenic amine degradation
  • Novel multicopper oxidase and application thereof to biogenic amine degradation
  • Novel multicopper oxidase and application thereof to biogenic amine degradation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 High-throughput screening of bacterial strains containing multiple copper oxidase genes

[0022] Primary screening medium (g / L): yeast extract 5, beef extract 5, peptone 5, NaCl 10, glucose 20, Tween-801mL / L, MgSO 4 0.2, MnSO 4 ·H 2 O 0.5, FeSO 4 0.4, triammonium citrate 2.0, CaCO 3 0.1, pyridoxal-5-phosphate 0.05, K 2 HPO 4 2.0, amino acid (histidine 3, tyrosine 3, lysine 3, tryptophan 3, arginine 3, ornithine 3, phenylalanine 3), bromocresol purple 0.6, adjust pH to 6.0±0.2.

[0023] LB medium (g / L): peptone 10, yeast powder 5, sodium chloride 10, pH 7.0±0.2.

[0024] MRS medium (g / L): yeast extract 4, beef extract 5, peptone 10, glucose 20 Tween 80 1mL / L, MgSO 4 0.2, MnSO 4 0.05,K 2 HPO 4 2. Triammonium citrate 2, sodium acetate 5, pyridoxal-5-phosphate 0.05, pH 6.0±0.2.

[0025] The detection method of various biogenic amine content: refer to GB / T5009.208-2008 Determination method of biogenic amine content in food.

[0026] Visible light...

Embodiment 2

[0037] Cloning and expression of embodiment 2 multi-copper oxidase gene

[0038] 1. Obtain the target fragment: design primers according to the gene sequence of the multi-copper oxidase in Weissella cibaria strain AB3b (GenBank accession number: NZ_JWHT01000002.1) in NCBI, and the primers are as follows (5'-3'):

[0039] Upstream CCGGAATTCATGAAAAACTATACGGACTATTTCTT

[0040] Downstream CCCAAGCTTTTAGTGGTGGTGGTGATGATGCATTTTCATTCCCATTTTT

[0041] Using the genome of W.cibaria as a template, the gene encoding multicopper oxidase was amplified by PCR. After the PCR amplification, the results of the PCR product in 1% agarose gel electrophoresis showed a target band of about 1500bp. The PCR product was purified with a DNA gel recovery kit, and the target fragment was recovered. After sequencing, the gene sequence of the multi-copper oxidase MCO derived from W.cibaria is shown in SEQ ID NO.1, and correspondingly, the amino acid sequences are shown in SEQ ID Shown in NO.2.

[0042] ...

Embodiment 3

[0049] The enzymatic property (temperature, pH, K of embodiment 3 multi-copper oxidase) m , V max )

[0050] TB medium (g / L): peptone 12, yeast powder 24, glycerol 5, K 2 HPO 4 ·3H 2 O 16.43, KH 2 PO 4 12H 2 O2.32, pH 7.0±0.2.

[0051] Preparation of crude enzyme solution: Induce expression of recombinant bacteria according to step 7 in Example 2, and obtain crude enzyme solution after ultrasonic crushing, pass through a 0.45 μL filter membrane for later use.

[0052] Purification of protein: wash the nickel column with 5-10 times column volume of deionized water at a flow rate of 5mL / min; add about 8-10 times column volume of Binding buffer at a flow rate of 5mL / min to balance the nickel column; Load the sample at a flow rate of 1mL / min; add about 8 to 10 times the column volume of Binding buffer at a flow rate of 5mL / min to balance the nickel column; use different concentrations of imidazole-containing phosphate buffer at a flow rate of 5mL / min The nickel column was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses novel multicopper oxidase and application thereof to biogenic amine degradation, and belongs to the technical field of molecular biology. The optimum pH of the multicopper oxidase is 3.5, the optimum temperature is 50 DEG C, and copper ions can promote enzyme activity and ensure that enzyme activity is improved by two times; the novel multicopper oxidase can tolerate 18 percent NaCl, and is obviously superior to the conventional multicopper oxidase. Multicopper oxidase recombinase has high biogenic amine degradation performance, is broad in degradation spectrum, can degrade tryptamine, phenylethylamine, putrescine, cadaverine, histamine, tyramine and spermidine within 24h, ensures that the degradation rate to total amine in a biogenic amine model system reaches 39 percent, and has the best degradation effect on histamine; the novel multicopper oxidase ensures that the degradation rate to total amine in soy sauce reaches 13 percent, and has obvious degradation effect on putrescine and phenylethylamine. The multicopper oxidase is beneficial to improvement of safety of fermented food.

Description

technical field [0001] The invention relates to a novel multi-copper oxidase and its application in degrading biogenic amines, and belongs to the technical field of molecular biology. Background technique [0002] Biogenic amine is a general term for a class of biologically active small-molecular-weight nitrogen-containing organic substances. When a variety of biogenic amines are ingested at the same time, it will cause allergic reactions such as headache, nausea, palpitations, changes in blood pressure, respiratory disorders, etc., and even life-threatening in severe cases. Common biogenic amines in food mainly include putrescine, cadaverine, spermine, spermidine, tyramine, phenylethylamine and histamine. [0003] At present, there are mainly three aspects to control biogenic amines in food. 1. Control from the source: control the content of free amino acids, the limitation is that it will affect the flavor of some high-protein foods; use strains without amino acid decarbo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N1/21A23L5/20A23L27/50C12R1/19
CPCA23L5/25A23L27/50C12N9/0008
Inventor方芳徐洁陈坚曾伟主
OwnerJIANGNAN UNIV