Method for identifying and analyzing specific locus interaction proteins on basis of CRISPR/cas9 and peroxidase APEX2 system

A technology of peroxidase and system identification, which is applied in the analysis of materials, biological tests, material inspection products, etc., can solve the problems of not being able to provide specific analysis of chromatin or genome-wide functions, changing the natural environment of chromatin, technical difficulties, etc. problems, to achieve high specificity, high sensitivity, and good reproducibility

Inactive Publication Date: 2019-03-22
FUDAN UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, a comprehensive understanding of chromatin function requires the identification of DNA, RNA, and transcription factors present at specific genomic loci, however, technical difficulties and challenges remain
[0003] Although many techniques to study the local chromatin composition have been proposed, for example, chromatin immunoprecipitation (ChIp) is a classic and widely used technique to study the genome-wide distribution of a given protein, however, none has been proposed so far. Widely accepted method for studying locally interacting molecules at a given genomic site; locked nucleic acid probes are used to identify proteins that bind to telomeric regions, but this method is limited to highly repetitive genomic regions; LexA DNA binding site Genetically integrated into the yeast genome for site-specific chromatin purification; however, this method requires genomic modification of the target genome, thus it alters the natural environment of chromatin and is inefficient; improved Genome editing technologies such as transcription activator-like effector nuclease (TALEN) and clustered regularly interspaced short palindromic repeats (CRISPR / cas9) have been used to enrich desired genomic loci, however, based on TALEN The method requires the design of an amino acid sequence for each site, and the CRISPR-based method needs to cross-link the cells with formaldehyde, and requires the availability of high-affinity and specific antibodies; Chromatin or genome-wide functional analysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying and analyzing specific locus interaction proteins on basis of CRISPR/cas9 and peroxidase APEX2 system
  • Method for identifying and analyzing specific locus interaction proteins on basis of CRISPR/cas9 and peroxidase APEX2 system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, construction and transfection of plasmid expression vector

[0033] 1.1 Construction of the plasmid expression vector: In order to construct the MS2-APEX2_NLS fusion protein expression vector, APEX2 was amplified from the pcDNA3 Connexin43-GFP-APEX2 (Addgene plasmid: 49385) plasmid by PCR, and then digested with BamHIandXhoI. Cloned to the pHAGE-EFS-MCP-3XBFPnls (Addgene plasma: 75384) vector, by connecting the annealed oligonucleotide fragment (oligos) and the BbsI restriction site to pLH-sgRNA1-2XMS2 (Addgene plasma : 75389) plasmid to complete the construction of sgRNA expression vector, express dCas9 with Addgene plasmid 64107, all sgRNA sequences are shown in Table 1:

[0034] Table 1. sgRNA sequences

[0035] name

Sequence(5'-3')

sgRNA-Telomere

TAGGGTTAGGGTTAGGGTTA

sgRNA-Gal4

AACGACTAGTTAGGCGTGTA

[0036] 1.2 HEK293T cell culture: HEK293T cells in 5% CO 2 and cultured in a 37°C incubator, the medium was high...

Embodiment 2

[0038] Embodiment 2, extract protein and carry out Western blot (Western blot) analysis experiment

[0039] 2.1 After 24 hours of cell transfection, when 4x10 7 When each cell was transfected with the target sgRNA or Gal4 control, the cells were treated with 500uM biotin-phenol (Iris Biotech GmbH, Germany) for 30min, and then hydrogen peroxide (H 2 o 2 ) to a final concentration of 1 mM and treat the cells for 1 min. Immediately thereafter, a reaction termination solution (10 mM sodium azide, 10 mM VC, 5 mM Trolox) was added to terminate the reaction. Harvest cells directly after terminating the oxidation reaction;

[0040] 2.2 Resuspend the cells with hypotonic buffer and lyse for 15 minutes. Centrifuge at 13000g for 10min at 4°C;

[0041] 2.3 Pre-cooled lysis buffer (50mM Tris, 150mM NaCl, 0.2% NP-40, 5% glycerol, 1.5mM MgCl 2 )Resuspended;

[0042] 2.4 Sonicate the resuspended solution (Diagenode Bioruptor, High, 10min, 30son, 30soff);

[0043] 2.5 The cell extract ...

Embodiment 3

[0049] Embodiment 3, SILAC (stable isotope labeling) analysis experiment

[0050] 3.1 Plate HEK293T cells into two T25 culture flasks, culture the cells with SILAC medium, the cells can absorb lysine and arginine or heavy or light isotopes into the cells through metabolism, and synthesize the proteome of the cells ;

[0051] 3.2 After culturing the cells for 8-10 days, check the labeling efficiency. Pick positive cells and expand them into T75 culture flasks;

[0052] 3.3 Transfect dcas9, MS2-APEX2_NLS, and sgRNA at the site of interest into heavy isotope-labeled cells, and transfect dcas9, MS2-APEX2_NLS, and sgRNA Gal4 into light isotope-labeled cells;

[0053] 3.4 24 hours after transfection, the light and heavy cell lines were labeled with biotin respectively. The method of cell lysis and interruption is the same as that in Example 2. Mix equal amounts of protein (2mg each) for the two treatments, then mix it with 100ul of M-280 streptavidin magnetic beads, and incubate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and relates to a method for identifying and analyzing specific locus interaction proteins on the basis of a CRISPR / cas9 and peroxidase APEX2 system. The method comprises the following steps: plasmid transformation; biotin labeling of specific locus binding protein complex; enrichment of biotin-labeled protein complex by utilizing streptomycin magnetic beads; and assay and analysis of enriched proteins. An experimental analysis result shows that the method is applicable to the research and analysis of protein at any given chromosomal location, and meanwhile, the idea that the method combines the CRISPR gene editing system with APEX2 to carry out specific locus protein analysis is also applicable to the combination of other genome editing methods (such as TALEN) and the APEX2. The method has the advantages of simplicity in operation, high sensitivity, high specificity, good repeatability and adaption to the requirement of the research of local chromatin interaction at any given chromosomal location.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for identifying and analyzing specific site interaction proteins based on CRISPR / cas9 and peroxidase APEX2 systems. Background technique [0002] The prior art discloses that in eukaryotic cells, DNA molecules are highly organized and tightly wrapped around repeating units of nucleosomes to form chromatin. However, in living cells, the structure of chromatin is dynamically changing, locally Chromatin is accessible by regulatory elements such as transcription factors and non-coding RNAs. In recent years, many mechanisms have been proposed to regulate the organization of chromatin. For example, each chromosome in the nucleus of eukaryotic cells is located in a specific region called a chromosome region, which contains many The domains of DNA are called topological domains; in topological domains, distal DNA elements regulate gene expression through dynamic interactions. Rese...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N33/68
CPCG01N33/68G01N33/6848
Inventor刘贇邱文青
OwnerFUDAN UNIV