A method to localize gzf3 to the cytoplasm to reduce urea accumulation in rice wine yeast

A technology of rice wine yeast and cytoplasm, applied in the field of genetic engineering, can solve problems such as affecting the safety of rice wine products

Active Publication Date: 2020-12-01
JIANGNAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The accumulated urea will spontaneously react with ethanol in the system to generate 2A potential carcinogen ethyl carbamate, which seriously affects the safety of rice wine products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method to localize gzf3 to the cytoplasm to reduce urea accumulation in rice wine yeast
  • A method to localize gzf3 to the cytoplasm to reduce urea accumulation in rice wine yeast
  • A method to localize gzf3 to the cytoplasm to reduce urea accumulation in rice wine yeast

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 The construction of rice wine yeast suitable for rapamycin-mediated regulatory protein subcellular localization

[0030] (1) Split the diploid Saccharomyces cerevisiae strain XZ-11 used for rice wine production to obtain haploid strains

[0031] According to the paper "Wu D H, Li X M, Shen C, et al.Isolation of a haploid from anindustrial Chinese rice wine yeast for metabolic engineering manipulation[J].Journal of the Institute of Brewing,2013,119(4):288-293 The method and steps described in the method and steps to obtain the haploid XZ-11a strain without resistance gene.

[0032] (2) Construction of auxotrophic haploid rice wine yeast JNZ01

[0033] Using the genome of rice wine yeast XZ-11 strain as a template, the upstream and downstream 300 bp sequences of the URA3 gene were respectively amplified, and the above two amplified fragments were fused by fusion PCR to obtain the URA3 gene knockout frame. The URA3 knockout frame was transformed into the XZ-11a...

Embodiment 2

[0042] Example 2 Fusion PCR construction fusion expression GZF3, FKBP12 recombination cassette

[0043] (GGGGS) was first transformed by whole-plasmid PCR 3 After the linker was introduced into the BamH I site on the high-copy plasmid vector pRS426-TEF-URA3, pRS426-TEF-GS-URA3 was obtained. FKBP12 was obtained by gene synthesis, and cloned into the EcoR I and Xho I sites of the vector pRS426-TEF-GS-URA3 by enzyme digestion to obtain pRS426-TEF-GS-FKBP12-URA3. A 500bp sequence without a stop codon at the end of GZF3 was amplified from the genome and cloned into the Spe I and BamH I sites of the vector pRS426-TEF-GS-FKBP12-URA3 by restriction enzyme digestion to obtain pRS426-TEF-Gzf3D-GS -FKBP12-URA3. Then, the obtained plasmid was used as a template for PCR amplification, and the 50 bp sequence downstream of GZF3 was introduced into the upstream primer to obtain the fusion expression GZF3 and FKBP12 recombination frame.

Embodiment 3

[0044] Example 3 Integration and fusion expression of GZF3 and FKBP12 recombination cassettes on the genome of recombinant rice wine yeast JNZ01 through the CRISPR-Cas9 system

[0045] First, according to Yeastriction (http: / / yeastriction.tnw.tudelft.nl / #! / ), design the 20nt sequence (AAACAAGAAGGGAATAAAGG) required to edit the GZF3 site on the genome using the CRISPR-Cas9 system. Using the plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene No. 43803) as a template, the 20nt sequence located at the CAN1 site on the original plasmid was replaced by the 20nt sequence by whole plasmid PCR to obtain p426-Gzf3sgRNA. The plasmid p414-TEF1p-Cas9-CYC1t (Addgene number 43802) was transformed into the recombinant rice wine yeast JNZ01, on the SC-trp1 plate (YNB 1.7g / L, ammonium sulfate 5g / L, glucose 20g / L, uracil 25mg / L , agar powder 20g / L) to screen positive transformants to obtain bacterial strain JNZ01-Cas9. The plasmid p426-Gzf3sgRNA and the fusion expression GZF3 and FKBP12 recombinati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for positioning Gzf3 on cytoplasm to reduce urea accumulation of yellow rice wine yeast and belongs to the field of genetic engineering. According to the method, recombinant yellow rice wine yeast JNZ01 (MATa, delta ura3, delta trp1, TOR1S1972R and delta fpr1) is used as a starting strain, GZF3 and FKBP12 are fused and expressed on a genome, and RPL13A and FRB arefused and expressed on a plasmid; rapamycin is added to combine the FKBP12 and the FRB. On the basis, the Gzf3 is transferred to the cytoplasm under the action of cytoplasm positioning protein Rpl13Aand urea is activated; related genes are transcribed to reduce the accumulation of the urea in a fermentation process is reduced by 21.51 percent and the accumulation of the urea is reduced to 12.80 mg / L.

Description

technical field [0001] The invention relates to a method for locating Gzf3 in the cytoplasm to reduce the accumulation of urea in rice wine yeast, which belongs to the field of genetic engineering. Background technique [0002] In the process of nitrogen source utilization by Saccharomyces cerevisiae, affected by the repression effect of nitrogen metabolites, cells preferentially use preferential nitrogen sources (such as glutamine, glutamic acid, etc.), while non-preferred nitrogen sources (such as urea, proline acid, etc.) Utilization-related gene expression was suppressed, which was a non-preferred nitrogen source utilization lag. The transcriptional repressor Gzf3 is one of the four global regulators of nitrogen metabolism repression in Saccharomyces cerevisiae. During nitrogen metabolism, Gzf3 enters the nucleus, binds to the promoter region of related genes, and represses the expression of genes related to non-preferential nitrogen utilization , leading to the inhibit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/81C12N15/90C12N1/19C12G3/022C12R1/865
CPCC07K14/395C12G3/02C12N15/81C12N15/905
Inventor周景文陈坚方芳张伟平曾伟主堵国成
OwnerJIANGNAN UNIV