Unlock instant, AI-driven research and patent intelligence for your innovation.

Mutated chitinase and application thereof

A technology of chitinase and chitin, which is applied in the field of genetic engineering, can solve problems such as shortening the process flow, achieve large application space, improve efficiency, and reduce costs

Active Publication Date: 2020-02-11
SHANDONG UNIV
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the practical application of SsChi18A, there are still problems to be solved; shortening the process flow and improving production efficiency urgently require the emergence of chitinase with higher activity
In order to expand the industrial application of SsChi18A, improving its enzymatic activity is a key task, however, there are no reports on the enhanced enzymatic activity of SsChi18A and its related mutant genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutated chitinase and application thereof
  • Mutated chitinase and application thereof
  • Mutated chitinase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1, mutation of chitinase SsChi18A and construction of recombinant vector

[0024] (1) Obtain chitinase SsChi18A gene from NCBI database, connect SsChi18A gene and plasmid pET28a to obtain pET28a-SsChi18A plasmid, the nucleotide sequence of the pET28a-SsChi18A plasmid is shown in SEQ ID No.3. Using the above-mentioned recombinant plasmid as a template, design mutation primers for site-directed mutation. The primer sequences are as follows:

[0025] K186A-sense: TCGGACGGAGGCGCACTCGACGCGG;

[0026] K186A-antisense: GAGTGCGCCTCCGTCCGAGGCGTCC;

[0027] The PCR amplification reaction system is as follows:

[0028]

[0029] The reaction procedure is as follows:

[0030] Preheating, 94°C, 5min; denaturation, 94°C, 30s; annealing, 55-65°C, 30s; 30cycles; extension, 72°C, 2min; re-extension, 72°C, 10min; 4°C, forever.

[0031] (2) Take 3 μL of the PCR product for agarose gel electrophoresis verification, leaving a reaction product with clear bands. The wild-typ...

Embodiment 2

[0039] Embodiment 2, construct the recombinant engineered bacterium that contains above-mentioned mutant gene SsChi18A_1

[0040] In this example, a recombinant engineering bacterium containing the above-mentioned mutant gene SsChi18A_1 was constructed. The specific steps are as follows: add 2 μL of the above-mentioned mutant plasmid pET28a-SsChi18A-K186A with correct sequencing to 50 μL of Escherichia coli BL-21 competent cells, bathe in ice for 30 minutes; heat at 42°C Hit for 90s; ice bath for 2min, add 1mL liquid LB, incubate in a shaker at 37°C for 1-1.5h; centrifuge at 8000rpm for 2min, discard the supernatant (leave a little bottom liquid). Spread the remaining solution on an LB plate containing 50 μg / mL kanamycin, spread evenly until dry, and incubate overnight at 37°C; pick a single clone the next day, and inoculate it in 5 mL of LB medium containing antibiotics, at 37°C Cultivate overnight at 200 rpm to obtain recombinant engineered bacteria containing the mutant gen...

Embodiment 3

[0041] Embodiment 3: Recombinant expression of mutant gene SsChi18A_1

[0042] Fermentative expression and purification of the mutant chitinase SsChi18A-K186A encoded by the above mutant gene SsChi18A_1, the specific steps are as follows:

[0043] (1) Heterologous expression of recombinant protein:

[0044] Get the recombinant engineering bacterium containing the above-mentioned mutant gene SsChi18A_1 obtained in Example 2, and culture overnight at 37° C. 200 rpm in 5 mL LB medium (containing 50 μg / mL kanamycin);

[0045] Transfer the cultured bacterial solution overnight to a 1L Erlenmeyer flask containing 300mL LB medium (containing 50μg / mL kanamycin), and culture it at 37°C for about 3 hours until OD600=0.6-0.8; the final concentration of adding 0.5 mM IPTG, induced culture at 20°C for 20h; centrifuge at 8000rpm, 4°C for 10min to obtain bacterial pellet;

[0046] NaH at pH 8.0 2 PO 4 -Resuspend the bacteria in NaCl buffer, put the bacteria in a 100mL centrifuge tube; pu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutated gene SsChi18A_1 of chitinase SsChi18A. A mutation site of the gene is k186A, a nucleotide sequence of the gene is shown in SEQ ID No.1. The invention also discloses application of the gene to preparation of the chitinase. An experiment proves that the activity of the mutated chitinase encoded by the gene is up to 84.2U / micro-mol, so that the activity of the mutated chitinase is increased by 55 percent in comparison with the activity of wild type enzyme; the mutated chitinase can bear a high temperature of 70 DEG C like the wild type enzyme, and is stable in abuffering system of which a pH value is 4 to 11; and the mutated chitinase has the characteristics of high activity and high temperature resistance, and can be applied to many fields of production ofoligosaccharide, preparation of protoplast, production processing of biopesticide, antifungal drugs, biological pesticides and the like.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a mutant chitinase and its application. Background technique [0002] Chitin, a poly-β-1,4-N-acetylglucosamine (NAG), is the second most abundant polysaccharide in nature after cellulose. Chitin is mainly derived from crustaceans, and the amount of chitin produced in water bodies is as high as 10 11 Ton. The process of demineralizing and deproteinizing chitin in biomass to obtain pure chitin is usually carried out with concentrated acid or alkali, but causes corrosion and creates environmental problems. Enzymatic degradation of chitin can produce a variety of pharmacologically active components, such as N-acetylglucosamine (NAG) and chitin oligosaccharide (CHOS), which can be used as drug delivery carriers and antioxidants in antitumor, wound healing, Plays a role in controlling blood cholesterol and food preservation. Chitinase has a wide range of sources, the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/70C12N1/21C12P19/26C12P19/14C12R1/19
CPCC12N9/2442C12N15/70C12P19/14C12P19/26C12Y302/01014
Inventor 王禄山孙晓萌赵越张怀强吴秀芸
Owner SHANDONG UNIV