Promoter sequence of fructokinase gene in apple, and deletion mutants and application of

A technology of promoter sequences and deletion mutants, applied in applications, genetic engineering, enzymes, etc., can solve problems such as hindering the normal growth of plants, breaking the metabolic balance, and dying.

Pending Publication Date: 2020-04-17
NORTHWEST A & F UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the research of apple genetic engineering and bioengineering, constitutive promoters are mainly used, such as the cauliflower mosaic virus 35S promoter (CaMV35S), which can make the foreign gene constant and continuous expression in various tissue parts, excessive It consumes the material and energy in the cell, and cannot effectively regulate the expression of exogenous target genes in time and space, so there are certain defects in the application
If the exogenous gene is expressed in the whole plant, a large amount of heterologous protein or metabolites will accumulate in the plant, breaking the original metabolic balance of the plant, which is not conducive to the improvement of yield and quality; some products are not necessary or even toxic to plants , thus hindering the normal growth of plants and even leading to death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter sequence of fructokinase gene in apple, and deletion mutants and application of
  • Promoter sequence of fructokinase gene in apple, and deletion mutants and application of
  • Promoter sequence of fructokinase gene in apple, and deletion mutants and application of

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: Cloning of the MdFRK2 promoter

[0054] 1. Submit the apple fructokinase gene MdFRK2 (MD04G1042400) to the Rosaceae database https: / / www.rosaceae.org / search / features , the 1780bp base sequence upstream of the start codon at the 5' end of the gene was used as the predicted full-length promoter sequence.

[0055] 2. Design forward and reverse primers PFRK2-F and PFRK2-R according to the promoter sequence obtained above:

[0056] PFRK2-F: CGCGCGTACCGAGTCTAATCACTGC

[0057] PFRK2-R: GGCAGGCGTGCAAACTGGCGAATT

[0058] 3. Using the whole genome DNA of 'Gala' apple as a template, MdFRK2 was amplified by PCR with the above primers. The PCR reaction program was: 94°C for 3min; 94°C for 45s, 58°C for 45s, 72°C for 60s, 35 cycles; 72°C 10min at ℃; forever at 4℃.

[0059] 4. The obtained PCR amplification products were detected by 1% agarose gel electrophoresis, and the PCR amplification products were recovered and purified (for steps, refer to the DNA Purificatio...

Embodiment 2

[0061] Example 2: Construction of plant expression vector of full-length promoter of MdFRK2 gene and transformation of Agrobacterium

[0062] 1. Construction of recombinant plasmid pBI121-MdFRK2

[0063] 1) The forward and reverse primers SEQ ID NO: 4PFRK2-F and PFRK2-R in 2 of Example 1 are introduced with restriction sites.

[0064] BamHI-PFRK2-F: GGATCC CGCGCGTACCGAGTCTAATCACTGC

[0065] HindIII-PFRK2-R: GAATTCGGCAGGCGTGCAAACTGGCGAATT

[0066] 2) Perform PCR amplification using the correct sequence identified in Example 1 as a template, and perform electrophoresis detection, purification and recovery of the obtained PCR product. The method is the same as in Example 1 above.

[0067] 3) BamHI and HindIII double enzyme digestion was carried out on the above recovered product at 37° C. for 2 hours (the enzyme digestion procedure was carried out according to the instructions). At the same time, the pBI121-MdFRK2 vector was digested with BamHI and HindIII for 5h.

[0068] 4...

Embodiment 3

[0078] Example 3: Analysis of the expression pattern of the full-length promoter of the MdFRK2 gene

[0079] In order to study the tissue and organ expression characteristics of the promoter, the recombinant Agrobacterium pBI121-MdFRK2 / GV3101 in Example 2 was transformed into Arabidopsis thaliana and poplar respectively. The operation steps are as follows:

[0080] 1. Genetic Transformation of Arabidopsis

[0081] 1) Obtaining the MdFRK2 promoter from Arabidopsis thaliana

[0082]The recombinant Agrobacterium pBI121-MdFRK2 / GV3101 obtained in Example 2 was used to transform Arabidopsis thaliana. The conversion steps are:

[0083] a. When the bolting height of wild-type Arabidopsis plants is about 5 cm, select plants with better growth for infection.

[0084] b. Add 2 μL of Agrobacterium containing the recombinant plasmid PMdFRK2::GUS to 50 mL of LB liquid medium containing kanamycin, rifampicin and streptomycin, cultivate at 28°C until OD600=1.2-1.5, centrifuge at 4000rpm f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Melting pointaaaaaaaaaa
Thicknessaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biological gene engineering and discloses a promoter sequence of a fructokinase gene in an apple, and deletion mutants and application of. A promoter isnamed as FH1 and is a 1780-bp nucleotide sequence at the upper stream of the 5'-end of an MdFRK2 gene coding frame in an apple; and the mutants are sequences obtained by deleting fragments with different lengths from the 5'-end of the sequence of FH1 and are named as FH2, FH3 and FH4 respectively. The invention further discloses application of the MdFRK2 promoter and the deletion mutants of the MdFRK2 promoter in research on plant functional genes. The MdFRK2 promoter can regulate and control the specific expression of a target gene in cambium of stem tip growth points, old leaves, functionalleaf margins and other library tissues of arabidopsis thaliana and poplar, and a fragment from a transcription starting site to upstream-600 bp is determined to be a core fragment of a promoter region of the MdFRK2 promoter. The full length of the MdFRK2 promoter is induced by exogenous sugar and drought, which indicates that the promoter has important application value in industrial developmentof plant genetic engineering.

Description

technical field [0001] The invention belongs to the technical field of biological genetic engineering, and in particular relates to a promoter sequence, a deletion mutant and an application of an apple fructokinase gene. Background technique [0002] Currently, closest prior art: Fructose is the sweetest natural carbohydrate in plants and other organisms, and its concentration is an important factor affecting fruit flavor. During plant growth and development, fructose not only acts as a signaling molecule to regulate the expression of many key genes in metabolism and defense responses, but also acts as an osmoprotectant under stress conditions such as drought and cold. Therefore, further research on fructose metabolism through molecular biological methods and means has potential application value for promoting plant growth, improving plant stress resistance or increasing fruit sweetness. [0003] Fructose kinase is an enzyme with high affinity and specificity for fructose, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H5/08A01H6/20A01H6/82A01H6/74A01H6/00
CPCC12N9/1205C12N15/8229C12N15/8225C12N15/8235C12N15/8273C12Y207/01004
Inventor李明军杨静静高萌马锋旺
OwnerNORTHWEST A & F UNIV