Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lactobacillus salivarius MG-587 and application thereof

A technology of Lactobacillus salivarius and bacterial liquid, applied in the field of microorganisms, can solve problems such as disorder, abnormal increase in blood sugar level, tissue and organ lesions, etc., and achieve the effect of reducing fat cells, reducing visceral fat weight, and improving liver function.

Active Publication Date: 2021-09-03
MEI YI TIAN BIOLOGICAL MEDICINE WUHAN CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Under normal circumstances, the human body can ensure the balance of the source and outlet of blood sugar through the two major regulatory systems of hormone regulation and nerve regulation to maintain normal blood sugar. However, under the influence of genetic factors, unreasonable diet, obesity, etc., the two major regulatory functions Disturbances will occur and lead to an abnormal increase in blood sugar levels, and long-term high blood sugar will cause lesions in various tissues and organs throughout the body, leading to the occurrence of various acute and chronic complications
However, there are many side effects when blood sugar is regulated by drugs such as commonly used acarbose, metformin, insulin, etc. Therefore, improving blood sugar levels through dietary therapy and intestinal probiotic regulation is the current key research direction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactobacillus salivarius MG-587 and application thereof
  • Lactobacillus salivarius MG-587 and application thereof
  • Lactobacillus salivarius MG-587 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Isolation, identification and performance measurement of embodiment 1 bacterial strain

[0025] 1. 16S rDNA identification

[0026] Take 5g of feces samples from healthy people, add them into 50mL of sterile water, oscillate and mix, and then serially dilute, spread on MRS+bromocresol purple and MRS+mupirocin lithium salt selective medium plates respectively, place at 37 ℃, anaerobic overnight culture, pick a single colony for purification, and then carry out 16S rDNA strain identification.

[0027] 16S rDNA identification: Genomic DNA extraction, using universal primers:

[0028] 27F: AGAGTTTGATCCTGGCTCAG;

[0029] 1492R: TACGGCTACCTTGTTACGACTT

[0030] The PCR amplification of the 16S rDNA fragment was carried out, and the amplified fragment was submitted to Qingke Biological Company for sequencing. The sequencing result is shown in the sequence table SEQ ID NO:1. After comparison, a strain of Lactobacillus salivarius was obtained, which was named Lactobacillus sa...

Embodiment 2

[0077] Example 2 Lipid-lowering efficacy of Lactobacillus salivarius MG-587

[0078] 1. Fat cell experiment

[0079] Cell differentiation induction: when the cell confluency is 70-80%, follow the CL-173 TM Harvest cells by trypsinization according to the subculture-related instructions provided in the product insert. Cells were seeded in preadipocyte expansion medium (90% DMEM, 10% calf serum) and grown for 48 hours, or until the culture reached 100% confluency. After an additional 48 hours of incubation, the preadipocyte expansion medium was removed from each well, and the same volume of differentiation medium (90% DMEM, 10% fetal bovine serum FBS, 1.0 μM dexamethasone, 0.5 mM methyl isobutylxanthine (IBMX), 10 μg / mL insulin). At the same time, according to the ratio of 1:1000, add inactivated bacteria solution.

[0080] Incubate in differentiation medium for 48 hours, replace the differentiation medium with adipocyte maintenance medium (90% DMEM, 10% fetal bovine serum...

Embodiment 3

[0094] Example 3 Animal experiment of Lactobacillus salivarius MG-587

[0095] 1. Materials

[0096] Bacterial suspension preparation: After the strain was activated and transferred twice, it was cultivated to the stationary phase under suitable culture conditions, 6000rpm / min, centrifuged for 10min to collect the bacterial cells, washed and resuspended with PBS.

[0097] Groups: conventional feed control group, high-fat feed control group (Changzhou Shuyishuer Biotechnology Co., Ltd.), probiotics treatment group, 5 mice in each group.

[0098] 2. Establishment of hyperlipidemia mouse model

[0099] 1) Experimental animals: 8-week-old male C57BL / 6J mice (SPF grade), fed in an environment with a constant temperature of 25±2°C, a relative humidity of 50±5, and a day-night cycle of 12 / 12h.

[0100] 2) After a week of normal diet (ND) adaptation, they were randomly divided into two groups according to body weight. One group was given normal maintenance diet as a blank control, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Lactobacillus salivarius MG-587 and application thereof. The Lactobacillus salivarius MG-587 has been preserved in the China General Microbiological Culture Collection Center on January 4th, 2021 with the preservation number being CGMCC No:21588. The Lactobacillus salivarius MG-587 is separated and identified from human feces for the first time, it is found through research that the strain can significantly reduce fat cells, reduce the weight of visceral fat and reduce the contents of cholesterol, triglyceride and low-density lipoprotein, and therefore the effects of reducing blood fat, reducing weight and improving liver functions are achieved; the strain also has an excellent blood sugar reducing function; the strain is from a healthy human body, has choline salt hydrolase activity and antibiotic resistance, is free of toxicity and antigen reaction, can serve as probiotics to be prepared into multifunctional medicine or functional food or health-care food, and has wide market prospects and application value.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a strain of Lactobacillus salivarius MG-587 and its application. Background technique [0002] Lactobacillus salivarius (Lactobacillus salivarius) belongs to Lactobacillus family, Lactobacillus genus, is a Gram-positive bacterium, does not produce spores, does not have catalase, oxidase and motility, can produce lactic acid, and can be used in both aerobic and anaerobic environments. Growth, belonging to facultative heterogeneous acidic strains, does not produce gas during glucose metabolism. Studies have found that Lactobacillus salivarius is a probiotic that can stimulate immune cells to secrete anti-allergic cytokines. Lactobacillus can secrete antibiotics, bacteriocins and other substances in the process of growth and metabolism, and can inhibit the growth of pathogenic bacteria and other functions. Lactobacillus salivarius is one of the strains approved ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A61K35/747A61P3/10A61P3/06A61P3/04A61P1/16A23L33/135C12R1/225
CPCC12N1/20A61K35/747A61P3/10A61P3/06A61P3/04A61P1/16A23L33/135A23V2002/00A23V2400/181A23V2200/328A23V2200/3262A23V2200/332A23V2200/30
Inventor 刘庆军沈鹤霄李国龙张帆
Owner MEI YI TIAN BIOLOGICAL MEDICINE WUHAN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com