Anti-white-spot-syndrome-virus transgenic algae strain as well as preparation method and application thereof
A kind of white spot syndrome and transgenic technology, applied in the field of genetic engineering, can solve the problems of difficult purification of target protein, limitation of application of prokaryotic expression system, difficult purification, etc., to improve the body's immunity and resistance, high nutritional value and medical value , The effect of simple genetic manipulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Preparation of WSSV envelope protein gene
[0030] 1) Preparation of WSSV genome:
[0031] WSSV-infected shrimp tissues were taken, and WSSV was purified by conventional low-temperature gradient centrifugation using 30-65% sucrose concentration. After purification, electron microscope observation was performed to identify the purity and integrity of the virus. Add an appropriate amount of TE buffer to the purified virus, digest with proteinase K at 65°C for 10 minutes, then add 1 / 10 volume of NaAc, extract once with equal volumes of phenol and chloroform, precipitate with cold absolute ethanol, and then add a little TE Dissolve to obtain pure WSSV DNA.
[0032] 2) Amplification of WSSV envelope gene vp28 gene
[0033] Primers were designed according to the published sequences of vp28 and vp19 in GenBank, where the upstream primer p1 of vp28: 5' TCTAGA ATGGATCTTTCTTTCACTTCTTTC 3', downstream primer p2: 5' GGATCC AATTGCTCGGTCTCAGTGCCAG 3', the upstream and...
Embodiment 2
[0045] Example 2 PCR product purification recovery and subcloning
[0046] 1) Purification and recovery of vp28 gene fragments
[0047] Purification and recovery of PCR products was carried out according to the operating instructions of the AxyPrep PCR cleaning kit. The main steps were: add 3 times the volume of Buffer A to the PCR reaction solution and mix well, then centrifuge at 12,000 g for 1 min; add 0.7 ml Buffer W2 to the preparation tube Afterwards, centrifuge at 12000 g for 1 min. Finally, add 30 μl of water to the center of the DNA preparation membrane to elute and recover the PCR fragment.
[0048] 2) The recovered vp28 gene fragments were first subjected to double enzyme digestion, and then ligated with the pMD18-T cloning vector that had undergone the same digestion. The ligation system was as follows:
[0049] 10× Ligation Buffer 2 μl
[0050] pMD18-T vector 1.5 μl
[0051] VP28 gene 7 μl
[0052] ddH2O 8 μl
[0053] T4 DNA Ligas...
Embodiment 3
[0058] Example 3 Construction process of pBI-vp28 eukaryotic expression vector
[0059] Perform the vp28 gene that was identified correctly by enzyme digestion and sequencing Double enzyme digestion, and then use the gel extraction method to purify the gene fragments. The eukaryotic vector PBI-221 was carried out Double enzyme digestion, gel recovery is also performed, and the digested carrier fragments are collected. The excised gene fragment and the vector fragment were ligated according to the following system, and the ligation system was placed overnight in a water bath at 16°C. The next day, the system was transformed into competent Escherichia coli, and the plasmid was extracted after provoking positive bacteria. Carry out double enzyme digestion identification. The constructed expression vector structure is as follows figure 2 shown.
[0060] The connection system is as follows:
[0061] 10× Ligation Buffer 5 μl
[0062] PBI-221 vector 2 μl
[0063] ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| electrical resistance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 