Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-white-spot-syndrome-virus transgenic algae strain as well as preparation method and application thereof

A kind of white spot syndrome and transgenic technology, applied in the field of genetic engineering, can solve the problems of difficult purification of target protein, limitation of application of prokaryotic expression system, difficult purification, etc., to improve the body's immunity and resistance, high nutritional value and medical value , The effect of simple genetic manipulation

Active Publication Date: 2014-03-26
LUOYANG RUILAI BIOLOGICAL ENG CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In these systems, due to the high cost of transgenic animals and animal cell culture systems, the contamination of protein products, and the difficulty of purification and scale-up, the application of the two systems is limited.
Although transgenic plants have the advantages of large-scale production and functional protein modification, they and their expression products are likely to cause environmental pollution, resulting in certain limitations in this system.
The currently widely used microbial expression system can overcome the shortcomings of the above expression systems, but it cannot perform transcription and post-translational modification of functional proteins in prokaryotic microbial systems (such as bacteria), and the expression products are prone to form insoluble inclusions body, which also limits the application of prokaryotic expression systems
Animal and plant virus vector systems also have certain limitations due to the possibility of spreading the virus to the external environment, high cost and difficulty in purifying the target protein.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-white-spot-syndrome-virus transgenic algae strain as well as preparation method and application thereof
  • Anti-white-spot-syndrome-virus transgenic algae strain as well as preparation method and application thereof
  • Anti-white-spot-syndrome-virus transgenic algae strain as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Preparation of WSSV envelope protein gene

[0030] 1) Preparation of WSSV genome:

[0031] WSSV-infected shrimp tissues were taken, and WSSV was purified by conventional low-temperature gradient centrifugation using 30-65% sucrose concentration. After purification, electron microscope observation was performed to identify the purity and integrity of the virus. Add an appropriate amount of TE buffer to the purified virus, digest with proteinase K at 65°C for 10 minutes, then add 1 / 10 volume of NaAc, extract once with equal volumes of phenol and chloroform, precipitate with cold absolute ethanol, and then add a little TE Dissolve to obtain pure WSSV DNA.

[0032] 2) Amplification of WSSV envelope gene vp28 gene

[0033] Primers were designed according to the published sequences of vp28 and vp19 in GenBank, where the upstream primer p1 of vp28: 5' TCTAGA ATGGATCTTTCTTTCACTTCTTTC 3', downstream primer p2: 5' GGATCC AATTGCTCGGTCTCAGTGCCAG 3', the upstream and...

Embodiment 2

[0045] Example 2 PCR product purification recovery and subcloning

[0046] 1) Purification and recovery of vp28 gene fragments

[0047] Purification and recovery of PCR products was carried out according to the operating instructions of the AxyPrep PCR cleaning kit. The main steps were: add 3 times the volume of Buffer A to the PCR reaction solution and mix well, then centrifuge at 12,000 g for 1 min; add 0.7 ml Buffer W2 to the preparation tube Afterwards, centrifuge at 12000 g for 1 min. Finally, add 30 μl of water to the center of the DNA preparation membrane to elute and recover the PCR fragment.

[0048] 2) The recovered vp28 gene fragments were first subjected to double enzyme digestion, and then ligated with the pMD18-T cloning vector that had undergone the same digestion. The ligation system was as follows:

[0049] 10× Ligation Buffer 2 μl

[0050] pMD18-T vector 1.5 μl

[0051] VP28 gene 7 μl

[0052] ddH2O 8 μl

[0053] T4 DNA Ligas...

Embodiment 3

[0058] Example 3 Construction process of pBI-vp28 eukaryotic expression vector

[0059] Perform the vp28 gene that was identified correctly by enzyme digestion and sequencing Double enzyme digestion, and then use the gel extraction method to purify the gene fragments. The eukaryotic vector PBI-221 was carried out Double enzyme digestion, gel recovery is also performed, and the digested carrier fragments are collected. The excised gene fragment and the vector fragment were ligated according to the following system, and the ligation system was placed overnight in a water bath at 16°C. The next day, the system was transformed into competent Escherichia coli, and the plasmid was extracted after provoking positive bacteria. Carry out double enzyme digestion identification. The constructed expression vector structure is as follows figure 2 shown.

[0060] The connection system is as follows:

[0061] 10× Ligation Buffer 5 μl

[0062] PBI-221 vector 2 μl

[0063] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
electrical resistanceaaaaaaaaaa
Login to View More

Abstract

The invention relates to an anti-white-spot-syndrome-virus transgenic algae strain as well as a preparation method and an application thereof. The natural relationship among shrimps, white spot syndrome virus (WSSV) and dunaliella cells is ingeniously utilized, the shrimps are infected by the WSSV, the shrimps use the dunaliella as bait, and the dunaliella cells belong to a green expression system and can be used for expressing and producing heterologous protein. WSSV cyst membrane protein genes, i.e. Vp19 and VP28 are obtained through the clone by a genetic engineering measure, the recombinant plasmid pBI-VP28, pBI-VP19 and pBI-VP28+VP19 are respectively built, the built recombinant plasmid is converted into the dunaliella cells, the converted dunaliella strain capable of stably expressing the virus cyst membrane protein is screened and cultured, the transgene dunaliella strain is directly fed to the shrimps as living body bait, and the immune protection effect on the shrimp bodies is improved. The prepared transgene dunaliella strain can be used for stably expressing the active protein, the protein does not need to be extracted and can be directly used as the live vaccines for feeding the shrimp bodies, the operation is convenient, the cost is low, safety and nontoxicity are realized, and the immune effect is high.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a preparation method of a transgenic algal strain resistant to white spot syndrome virus, and also relates to the application of the transgenic algal strain as medicine and feed (or feed additive) in actual production. Background technique [0002] White Spot Syndrome Virus (WSSV) is currently the pathogen with the strongest virulence, the fastest transmission speed and the highest lethality in the shrimp farming industry. Recent studies have shown that VP28 and VP19 are two important envelope proteins of WSSV, both of which play a key role in the virus infecting the host. Studies have shown that after WSSV VP28 and VP19 envelope protein genes are expressed in prokaryotic systems (such as Escherichia coli) and eukaryotic systems (such as yeast, silkworm and other hosts), the expression products have biochemical properties and immunological activities simi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/13C12N15/79A61K39/12A61P31/20A23K1/16A23K1/18C12R1/89C12R1/93
Inventor 冯书营李三强李爱芳薛云宋霄薇黄倢薛乐勋麻开旺景爱华冯文坡
Owner LUOYANG RUILAI BIOLOGICAL ENG CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com