Method for producing 2R,3R-butanediol by utilizing Klebsiella pneumoniae
A technology based on Klebsiella pneumoniae and butanediol, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., to achieve the effect of improving overall economic benefits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0029] The CGMCC1.6366 strain in this example is preserved by the China General Microorganism Culture Collection and Management Center, and has ampicillin resistance.
[0030] 1) Prepare seed medium
[0031] Peptone 10g / L, yeast powder 5g / L, sodium chloride 5g / L, prepared with tap water, dispensed into 250mL Erlenmeyer flasks with a liquid volume of 50mL, and sterilized.
[0032] 2) Allocation of glycerol, nitrogen source, phosphorus source and other components to make fermentation medium
[0033] Glycerin 30g / L, Ammonium Sulfate 4g / L, Dipotassium Hydrogen Phosphate 0.69g / L, Potassium Dihydrogen Phosphate 0.25g / L, Magnesium Sulfate 0.2g / L, Yeast Powder 1.5g / L, Trace Elements 1.0ml / L, Iron solution 1.0ml / L.
[0034] Among them, trace elements are: manganese sulfate 100mg / L, zinc chloride 70mg / L, sodium molybdate 35mg / L, boric acid 60mg / L, cobalt chloride 200mg / L, copper sulfate 29.28mg / L, nickel chloride 25mg / L L, concentrated hydrochloric acid (37%) 0.9ml / L.
[0035] The i...
Embodiment 2
[0043] 1. Construction of Klebsiella pneumoniae CGMCC1.6366budC mutant strain
[0044] Proceed as follows:
[0045] 1. Use PCR to amplify Klebsiella pneumoniae butanediol dehydrogenase (budC) and the upstream and downstream adjacent sequences, connect to the cloning vector by TA cloning method, and perform DNA sequence determination.
[0046] According to the genome information of Klebsiella pneumoniae MGH78578 (Genbank: CP000647), the butanediol dehydrogenase PCR primers were designed, the upstream primer budC-s: GCCATCCAGGAAGAGAAAAAATATCA (shown in SEQ ID NO.1), the downstream primer budC-a: AGACGTTTGTACGCCTGGGTAGAAG (shown in SEQ ID NO.2).
[0047] Using the above primers, Klebsiella pneumoniae CGMCC1.6366 genomic DNA was used as a template to amplify by PCR to obtain butanediol dehydrogenase (budC) gene fragment, which was connected to the pMD-18T simple plasmid (commercial product), named as pMD18T-budC plasmid, the sequence results are as follows:
[0048] The sequenc...
Embodiment 3
[0083] 1) Prepare seed medium and fermentation medium
[0084] Prepare seed medium and fermentation medium according to Example 1.
[0085] 2) Seed culture
[0086] Insert the Klebsiella pneumoniae CGMCC1.6366-budC- bacterial lawn prepared in Example 2 into the Erlenmeyer flask equipped with the seed medium, aerobic culture in a shaker at 42°C, and the rotation speed is 200 rpm, and cultivate for 12 Hour.
[0087] 3) Fermentation culture
[0088] Put a bottle of cultivated seeds into a 5L fermenter with 4L fermentation medium, ventilation rate 1L per minute, stirring speed 150 rpm, temperature 42°C, use sodium hydroxide solution to control the fermentation process pH7.5 , when the glycerol concentration was reduced to 5g / L, feed glycerin, control the glycerol concentration in the range of 5-40g / L, and ferment and cultivate for 70 hours.
[0089] According to the gas chromatographic conditions in Example 1, the fermentation broth components were detected, and the results we...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More