Method for producing 2R,3R-butanediol by utilizing Klebsiella pneumoniae

A technology based on Klebsiella pneumoniae and butanediol, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., to achieve the effect of improving overall economic benefits

Active Publication Date: 2014-04-23
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] There is no report on the production of 2R,3R-butanediol by fermentation of Klebsiella pneumoniae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The CGMCC1.6366 strain in this example is preserved by the China General Microorganism Culture Collection and Management Center, and has ampicillin resistance.

[0030] 1) Prepare seed medium

[0031] Peptone 10g / L, yeast powder 5g / L, sodium chloride 5g / L, prepared with tap water, dispensed into 250mL Erlenmeyer flasks with a liquid volume of 50mL, and sterilized.

[0032] 2) Allocation of glycerol, nitrogen source, phosphorus source and other components to make fermentation medium

[0033] Glycerin 30g / L, Ammonium Sulfate 4g / L, Dipotassium Hydrogen Phosphate 0.69g / L, Potassium Dihydrogen Phosphate 0.25g / L, Magnesium Sulfate 0.2g / L, Yeast Powder 1.5g / L, Trace Elements 1.0ml / L, Iron solution 1.0ml / L.

[0034] Among them, trace elements are: manganese sulfate 100mg / L, zinc chloride 70mg / L, sodium molybdate 35mg / L, boric acid 60mg / L, cobalt chloride 200mg / L, copper sulfate 29.28mg / L, nickel chloride 25mg / L L, concentrated hydrochloric acid (37%) 0.9ml / L.

[0035] The i...

Embodiment 2

[0043] 1. Construction of Klebsiella pneumoniae CGMCC1.6366budC mutant strain

[0044] Proceed as follows:

[0045] 1. Use PCR to amplify Klebsiella pneumoniae butanediol dehydrogenase (budC) and the upstream and downstream adjacent sequences, connect to the cloning vector by TA cloning method, and perform DNA sequence determination.

[0046] According to the genome information of Klebsiella pneumoniae MGH78578 (Genbank: CP000647), the butanediol dehydrogenase PCR primers were designed, the upstream primer budC-s: GCCATCCAGGAAGAGAAAAAATATCA (shown in SEQ ID NO.1), the downstream primer budC-a: AGACGTTTGTACGCCTGGGTAGAAG (shown in SEQ ID NO.2).

[0047] Using the above primers, Klebsiella pneumoniae CGMCC1.6366 genomic DNA was used as a template to amplify by PCR to obtain butanediol dehydrogenase (budC) gene fragment, which was connected to the pMD-18T simple plasmid (commercial product), named as pMD18T-budC plasmid, the sequence results are as follows:

[0048] The sequenc...

Embodiment 3

[0083] 1) Prepare seed medium and fermentation medium

[0084] Prepare seed medium and fermentation medium according to Example 1.

[0085] 2) Seed culture

[0086] Insert the Klebsiella pneumoniae CGMCC1.6366-budC- bacterial lawn prepared in Example 2 into the Erlenmeyer flask equipped with the seed medium, aerobic culture in a shaker at 42°C, and the rotation speed is 200 rpm, and cultivate for 12 Hour.

[0087] 3) Fermentation culture

[0088] Put a bottle of cultivated seeds into a 5L fermenter with 4L fermentation medium, ventilation rate 1L per minute, stirring speed 150 rpm, temperature 42°C, use sodium hydroxide solution to control the fermentation process pH7.5 , when the glycerol concentration was reduced to 5g / L, feed glycerin, control the glycerol concentration in the range of 5-40g / L, and ferment and cultivate for 70 hours.

[0089] According to the gas chromatographic conditions in Example 1, the fermentation broth components were detected, and the results we...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing 2R,3R-butanediol by utilizing Klebsiella pneumoniae. Butanediol reductase gene budC deactivated Klebsiella pneumoniae is used for producing the 2R,3R-butanediol under an oxygen limited condition by taking glycerin as a carbon source. A 2R,3R-butanediol product obtained by the method has high optical purity.

Description

technical field [0001] The invention relates to a method for producing 2R, 3R-butanediol, in particular to a method for producing 2R, 3R-butanediol by Klebsiella pneumoniae. Background technique [0002] Klebsiella pneumoniae is an important industrial microorganism for the production of industrial products such as 1,3-propanediol, 2,3-butanediol, acetoin, and 2-keto-D-gluconic acid. [0003] 2,3-Butanediol is a bulk chemical used in industries such as synthetic plastics and rubber, and is also considered a potential biofuel, 2S,3S-Butanediol and 2R,3R-Butanediol Due to its low freezing point, it can be used in antifreeze (Celinska E, Grajek W, Biotechnological production of 2,3-butanediol-Current state and prospects. Biotechnol Adv, 2009, 27, 715-725). 2,3-butanediol has two chiral carbons, forming three stereoisomers of meso-2,3-butanediol, 2S,3S-butanediol and 2R,3R-butanediol. 2S,3S-butanediol and 2R,3R-butanediol are enantiomers with the same properties such as crysta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P7/18C12R1/01
Inventor郝健魏东史吉平姜标陈川
OwnerSHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI