Aflatoxin detoxification enzyme with increased trypsin resistance
A technology of aflatoxin and trypsin, which is applied in the directions of oxidoreductase, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of chemical detoxification methods that do not have application value, rapid application effect, and poor specificity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: PCR amplification and sequencing of aflatoxin detoxification enzyme gene
[0027] 1. The present invention uses the sequence of the aflatoxin detoxifying enzyme gene (AY941095.1) derived from Armillaria armillaria as a reference, uses the software Primer 5 to design and synthesize two oligonucleotide primers, and extracts DH-5α by alkaline lysis. The PSA plasmid was used to amplify the ADTZ target gene by PCR.
[0028] The two PCR primers are as follows:
[0029] Forward primer:
[0030] 5' GTTTCTTCGAATTCGCGGCCGCTTCTAGA ATGGCCACCACAACTGTCC 3';
[0031] Reverse primer:
[0032] 5' GTTTCTTCCTGCAGCGGCGCTACTAGT TCACAATCGTCTCTCAATGAAACT 3'.
[0033] The underlined part is the linker, and the blue bases are EcoRI, XbaI, SpeI, and Pest restriction endonuclease sites respectively.
[0034] The PCR reaction system is as follows:
[0035]
[0036] PCR program setting:
[0037] Pre-denaturation at 94°C for 2 minutes;
[0038] 94°C, 15s; 67°C, 30s;
[003...
Embodiment 2
[0042] Embodiment 2: aflatoxin detoxification enzyme gene (ADTZ) and cloning vector Tao x Connection of +PgHT+PB 1. The mADTZ target gene and the cloning vector Tao x +PgHT+PB were respectively digested with restriction endonucleases EcoRI and SpeI / XbaI at 37°C for 10 min, and the digestion conditions were as follows:
[0043]
[0044] 2. After the digested products were subjected to 1% agarose gel electrophoresis, the two target fragments were respectively recovered and ligated with T4DNA ligase. The ligation system was as follows:
[0045] ADTZ digestion product
[0046]Ligate with ligase for 3 hours at 22°C, transform the ligation product into DH5a competent cells and amplify, extract the plasmid with a plasmid extraction kit, digest with EcoRI and PestI, and then run electrophoresis results show two bands of 7.5kb and 2.1kb, It indicated that the connection was successful, and it was determined to be the aflatoxin detoxification enzyme gene by DNA sequencing....
Embodiment 3
[0047] Embodiment 3: gene fragment Pao x +SS 1 with the cloning vector M+Tao x +PgHT+PB connection
[0048] 1. Gene fragment Pao x +SS 1 The cloning vector Pao x +SS 1 +Taken from PB, obtained by double digestion with EcoRI and SpeI endonucleases, purification and recovery;
[0049] 2. Cloning vector M+Tao x +PgHT+PB is obtained by embodiment 2, gene fragment Pao x +SS 1 with the cloning vector M+Tao x The connection method of +PgHT+PB is the same as in Example 2.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap