Aflatoxin detoxification enzyme with increased trypsin resistance

A technology of aflatoxin and trypsin, which is applied in the directions of oxidoreductase, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of chemical detoxification methods that do not have application value, rapid application effect, and poor specificity.

Active Publication Date: 2017-11-17
GUANGDONG GENUIZYMES ANIMAL HEALTH CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Due to the good thermal stability and high temperature resistance of aflatoxins, most of the toxins contained in the feed are gradually released during the decomposition process in the digestive tract of animals, and chemical detoxification methods usually do not have the application value in feed; The traditional physical adsorption method has poor specificity, and the application effect is a controversial issue

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aflatoxin detoxification enzyme with increased trypsin resistance
  • Aflatoxin detoxification enzyme with increased trypsin resistance
  • Aflatoxin detoxification enzyme with increased trypsin resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: PCR amplification and sequencing of aflatoxin detoxification enzyme gene

[0027] 1. The present invention uses the sequence of the aflatoxin detoxifying enzyme gene (AY941095.1) derived from Armillaria armillaria as a reference, uses the software Primer 5 to design and synthesize two oligonucleotide primers, and extracts DH-5α by alkaline lysis. The PSA plasmid was used to amplify the ADTZ target gene by PCR.

[0028] The two PCR primers are as follows:

[0029] Forward primer:

[0030] 5' GTTTCTTCGAATTCGCGGCCGCTTCTAGA ATGGCCACCACAACTGTCC 3';

[0031] Reverse primer:

[0032] 5' GTTTCTTCCTGCAGCGGCGCTACTAGT TCACAATCGTCTCTCAATGAAACT 3'.

[0033] The underlined part is the linker, and the blue bases are EcoRI, XbaI, SpeI, and Pest restriction endonuclease sites respectively.

[0034] The PCR reaction system is as follows:

[0035]

[0036] PCR program setting:

[0037] Pre-denaturation at 94°C for 2 minutes;

[0038] 94°C, 15s; 67°C, 30s;

[003...

Embodiment 2

[0042] Embodiment 2: aflatoxin detoxification enzyme gene (ADTZ) and cloning vector Tao x Connection of +PgHT+PB 1. The mADTZ target gene and the cloning vector Tao x +PgHT+PB were respectively digested with restriction endonucleases EcoRI and SpeI / XbaI at 37°C for 10 min, and the digestion conditions were as follows:

[0043]

[0044] 2. After the digested products were subjected to 1% agarose gel electrophoresis, the two target fragments were respectively recovered and ligated with T4DNA ligase. The ligation system was as follows:

[0045] ADTZ digestion product

[0046]Ligate with ligase for 3 hours at 22°C, transform the ligation product into DH5a competent cells and amplify, extract the plasmid with a plasmid extraction kit, digest with EcoRI and PestI, and then run electrophoresis results show two bands of 7.5kb and 2.1kb, It indicated that the connection was successful, and it was determined to be the aflatoxin detoxification enzyme gene by DNA sequencing....

Embodiment 3

[0047] Embodiment 3: gene fragment Pao x +SS 1 with the cloning vector M+Tao x +PgHT+PB connection

[0048] 1. Gene fragment Pao x +SS 1 The cloning vector Pao x +SS 1 +Taken from PB, obtained by double digestion with EcoRI and SpeI endonucleases, purification and recovery;

[0049] 2. Cloning vector M+Tao x +PgHT+PB is obtained by embodiment 2, gene fragment Pao x +SS 1 with the cloning vector M+Tao x The connection method of +PgHT+PB is the same as in Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an aflatoxin detoxification enzyme with improved resistance to trypsin. The invention transforms the key amino acid residues in the outer part of the three-dimensional structure of the wild-type aflatoxin detoxifying enzyme through protein engineering technology, and provides an ADTZ mutant with improved resistance to trypsin. The mutant aflatoxin detoxifying enzyme (ADTZK221C / K252Q / K278S) acting on aflatoxin described in the present invention has 2.73 times higher resistance to trypsin than wild-type ADTZ, and its half-life is 72 minutes longer than the wild-type enzyme , and other enzymatic properties are basically the same as the wild-type enzyme.

Description

technical field [0001] The invention relates to aflatoxin detoxification enzyme, in particular to aflatoxin detoxification enzyme with improved resistance to trypsin. Background technique [0002] Aflatoxins are mainly highly toxic secondary metabolites produced by fungi such as A. , AFGM1, AFGM2, among which the most toxic aflatoxin B1 is considered to be a class of strong carcinogenic mutagen with the potential to be extremely harmful to humans. Ingesting a large amount of aflatoxin B1 at one time can cause acute poisoning of humans and animals, Even death; long-term intake of small doses can cause teratogenicity, mutagenesis and carcinogenicity, even if the content of tens of ppb is still extremely toxic; Aflatoxin feed can cause animal weight loss or cause disease. Aflatoxin that enters the human body indirectly through the food chain has a strong carcinogenic effect and seriously threatens human health. Therefore, it is of great significance to solve the pollution of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12N1/19C12R1/645C12R1/84
CPCC12N9/0004C12N15/81C12N1/145C12N1/165C12R2001/645C12R2001/84
Inventor 姚冬生邱玉信谢春芳刘大岭
Owner GUANGDONG GENUIZYMES ANIMAL HEALTH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap