Rice arsenate reductase gene oshac4 and its application
A reductase, rice technology, applied in the field of plant genetic engineering, can solve the problem of no change in trivalent arsenic
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Embodiment 1, screening and phenotype of mutants
[0066] With all the phf1 (japonica rice black japonica 2 (HJ2) background) in this laboratory as the original material, the population after EMS (Ethylmethylsulfonate) mutagenesis is used as the object to screen the mutants; the EMS (Ethylmethylsulfonate) mutagenesis method is specific It is: choose plump, no damage by diseases and insect pests, uniform size, phf1 seeds with a germination rate of 95-100%, put them in mesh bags (250 grams per bag), and soak them in distilled water for 24 hours. After drying, treat with EMS solution for 10 hours and rinse with tap water for 4 hours. The treated seeds were propagated for one generation, and the seeds were harvested from a single plant for mutant screening.
[0067] After the seeds were dried, they were rinsed with ultrapure water and then washed with 1% HNO 3 (v / v) Dormancy breaking treatment for 16 hours, dark treatment in a 37°C incubator for about two days to accelera...
Embodiment 2
[0070] Embodiment 2, gene cloning
[0071] The phf1 / hac4 mutant was used as the female parent, and the phf1 was used as the male parent for crossing to obtain F 2 The seeds of the first generation were cultured in the presence of 20 μM Na 3 AsO 4 25 arsenic-sensitive phenotypes (similar phenotypes to phf1 / hac4, that is, 20 μM Na 3 AsO4 Under the condition of , the root length is the same as that of the wild-type HJ2) the genomic DNA was extracted from a single plant. Take about 0.1 g of young rice leaves, freeze them with liquid nitrogen, grind the leaves into powder in a 1.5 ml centrifuge tube, extract the total DNA, and dissolve the obtained DNA in 200 μl sterile water. 25 DNAs were mixed in equal amounts and sent to the company for gene resequencing and SNP analysis. The sequencing results found that a mutation (from G to A) occurred at the 3142971th base position of the genome of chromosome 2, and this site The SNPs on both sides showed a linkage phenomenon (Table 1). ...
Embodiment 3
[0076] Embodiment 3, mutant reply verification
[0077] In order to further confirm that the mutation of OsHAC4 caused the phenotypic changes of the mutant phf1 / Oshac4, a transgene reverting experiment was used to verify. According to the OsHAC4 gene promoter and genome sequence, the primers were designed as follows:
[0078] Upstream sequence: CCATGATTACGAATTCATTTTCTCTCATATAATAGCAT
[0079] Downstream sequence: CGACTCTAGAGGATCCTTACTGTTGATGAGCTGCAGGT
[0080] Using the japonica rice HJ2 genomic DNA as a template, the OsHAC4 promoter and genome sequence were amplified, connected into the pCAMBIA1300 vector by the INFUSION (clontech) method, and the ligated product was heat-shocked to transform Escherichia coli DH5α competent cells. After the enzyme digestion test is correct, it is ready for use. pCAMBIA1300 is a modified vector in our laboratory, which is an enhanced expression vector obtained by inserting the 35S promoter and Nos terminator at the multiple cloning site base...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More