Alanine dehydrogenase mutant and application thereof

A technology of alanine dehydrogenase and mutants, which is applied in the field of alanine dehydrogenase mutants and its application, and can solve the problems of reduced enzyme activity of alanine dehydrogenase and unfavorable L-alanine production, etc. , to achieve the effect of efficient production

Active Publication Date: 2018-04-20
金华利家园生物工程有限公司 +1
View PDF10 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The suitable growth temperature for Escherichia coli is 25-45°C. If the temperature is too high or too low, it is not conducive to the growth of the bacteria and the accumulation of the target product. Production of L-alanine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alanine dehydrogenase mutant and application thereof
  • Alanine dehydrogenase mutant and application thereof
  • Alanine dehydrogenase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Acquisition of Thermophilic Archaeal Alanine Dehydrogenase Gene

[0028] (1) Inoculate the purchased thermophilic archaea in nutrient broth medium, collect the bacteria after culturing at 80°C for 10 hours, and extract genomic DNA using a bacterial genome extraction kit;

[0029] (2) using primers alaD1 (5'ATGGAGACTCTTATTTTGACTCAGG 3', SEQ ID NO.5) and alaD2 (5'TCATATCCTGAAAAACTTTATTTTA3', SEQ ID NO.6) to clone the AFalaD gene encoding alanine dehydrogenase from genomic DNA;

[0030] (3) Connect the gene to the PMD19 simple cloning vector for sequencing to obtain a gene sequence such as SEQ ID NO.1;

[0031] (4) The AFalaD* gene was obtained after codon optimization of SEQ ID NO.1 according to the codon expression preference of the E.coli gene. The gene sequence is as shown in SEQ ID NO.2. After optimization, the GC content of the gene was reduced from 50.5% to 48.9 %, the codon adaptation index (CAI) increased from 0.222 to 0.974;

[0032] (5) The genes AF...

Embodiment 2

[0037] Example 2: Protein engineering of thermophilic archaeal alanine dehydrogenase

[0038] (1) Using Modeller software to model the homology of AFAlaD protein (JMB 342, 119-130 (2004)), the key amino acids K41, R52, K65, R108, and D297 of the loop structure of the catalytic active center of AFalaD* gene were mutated into Alanine; After the mutation, construct the recombinant strain according to the method in Example 1, and carry out enzyme activity detection, the results are shown in Table 2, the 41st lysine K and the 65th lysine K are mutated into alanine A, AFAlaD The optimum temperature for enzyme activity decreased to 77°C and 72°C respectively, so two sites were selected for combined mutation.

[0039] Table 2 Determination of enzyme activity of different mutants

[0040]

[0041] (2) Combining mutations of K41 and K65, it is found that when the 41st lysine K is mutated to histidine H, and the 65th lysine K is mutated to tryptophan W, that is, the 122nd base in SEQ...

Embodiment 3

[0042] Embodiment 3: the construction of high-yield L-alanine Escherichia coli

[0043] Using E.coli K12 as the starting strain, the key genes in the synthesis pathway of acetic acid, formic acid, ethanol, succinic acid, and lactic acid metabolites were knocked out by the Red homologous recombination method: acetate kinase gene ack-pta, pyruvate formate lyase gene pflB , alcohol dehydrogenase gene adhE, fumarate reductase gene frdA, fermentative D-lactate dehydrogenase gene ldhA, to obtain E.coliΔ5 strain, and integrate and express the AFalaD** gene derived from thermophilic archaea after protein engineering In E.coliΔ5, the genes encoding L-alanine dehydrogenase alaD and alanine racemase dadX were replaced to obtain engineering strain E.coliΔ5D2. The recombinant strain culture does not require the addition of antibiotics or inducers.

[0044] The above method adopts the Red homologous recombination system method:

[0045] 1) Introduce DNA fragment 1 with homology arm and ka...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alanine dehydrogenase mutant and application thereof, and belongs to the technical field of biological engineering. According to the alanine dehydrogenase mutant, archaeoglobus fulgidus derived alanine dehydrogenase is modified through protein engineering; an optimal enzyme-activity temperature of the alanine dehydrogenase is decreased from 82 DEG C to 50 DEG C; a key gene on a synthetic competitive route of L-alanine is cancelled in bacillus coli K12; the generation of by-products is reduced; an alaD gene and an alanine racemase dadX gene for coding the L-alanine dehydrogenase in a recombinant strain are replaced with modified archaeoglobus fulgidus derived alanine dehydrogenase genes; the two-stage fermentation is carried out by utilizing the recombinant strain; the fermentation is carried out for 42h; a yield of the L-alanine reaches 153.9g / L, and a sugar-acid conversion ratio is 81.0 percent.

Description

technical field [0001] The invention relates to an alanine dehydrogenase mutant and application thereof, belonging to the technical field of bioengineering. Background technique [0002] L-alanine is one of the smallest chiral molecules. It is a white crystal or crystalline powder with a sweet taste and is easily soluble in water. It has a wide range of uses in the food and pharmaceutical industries. In the field of food industry, as a natural sweetener, L-alanine can not only improve the nutritional value of food, but also improve the taste of artificial sweeteners, making them like natural sweeteners. In the field of medicine, L-alanine is often used as an amino acid nutritional supplement, and at the same time, L-alanine is also an important raw material chemical for the synthesis of vitamin B6, calcium pantothenate and other organic compounds. [0003] The main method of L-alanine production is to use immobilized L-aspartic acid-β-decarboxylase or cell suspension of Pse...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/06C12N15/53C12N15/70C12N1/21C12P13/06C12R1/19
CPCC12N9/0016C12N15/70C12P13/06C12Y104/01001
Inventor齐俊平张帆刘佳刘立明
Owner金华利家园生物工程有限公司