Naringenin production method based on phomopsis cell fermentation

A technology of P. phomophie and cell fermentation, which is applied in the fields of molecular biology and biology, can solve the problems of inability to guarantee product chirality, functional verification of enzyme activity, long plant growth cycle, etc., achieves good application prospects, overcomes long cycle, Easy to use effect

Pending Publication Date: 2019-09-27
NANJING NORMAL UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problems to be solved in the present invention are the problems of long plant growth cycle, low content, and complex metabolites in the prior art, the extreme reaction conditions of the chemical synthesis method, high cost, and the limitation that the chirality of the product cannot be guaranteed. There are technical problems such as enzymatic activity and functional verification, and the purpose of the present invention is to provide a method for producing naringenin based on Phomopsis cell fermentation, and directly prepare naringenin through a new liquid fermentation method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Naringenin production method based on phomopsis cell fermentation
  • Naringenin production method based on phomopsis cell fermentation
  • Naringenin production method based on phomopsis cell fermentation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Activation of wild-type Phomopsis species

[0037] The wild-type Phomopsis species is isolated from the stem endothelium of Euphorbiaceae Chongyang wood. The activation of the strain is to scrape a little Phomopsis mycelium from the PDA solid medium stored in the test tube and inoculate it into a 50mL PDA liquid culture medium. culture medium at 28°C and 180rpm for 48h, then transfer 2mL of mycelia liquid from the above bacterial liquid to 50mL of fresh PDA liquid medium, and continue to cultivate at 28°C and 180rpm for 36h to obtain protoplasts Prepared bacteria solution. Described PDA liquid culture medium is made of potato 200g L -1 and glucose 20g L -1 composition.

[0038] The PDA liquid culture medium in the above-mentioned example can also be used to add 10g L -1 Glucose was replaced by a synthetic medium consisting of glucose 10 g L -1 , ammonium sulfate 2g L -1 , sodium dihydrogen phosphate 3g L -1 , yeast extract 1g L -1 , magnesium sulfate ...

Embodiment 2

[0039] Embodiment 2: the preparation of protoplast

[0040] (1) Use a nylon membrane to filter the Phomopsis mycelia liquid cultured for 36 hours to obtain mycelia, and then use 0.6M MgSO 4 The mycelium was cleaned, and 1 g of wet mycelium was taken in 10 mL of lysate (20 mg Trichoderma, 20 mg Yatalase, 0.8 M NaCl to 10 mL), and incubated at 28° C. and 80 rpm for 13 h.

[0041] (2) Take it out after incubation for 13h, centrifuge at 3000rpm for 10min, discard the supernatant, and wash with 5mL STC buffer (sorbitol 1.2mol L -1 , CaCl 2 10mM·L -1 , Tris·HCl 10mM·L -1 , pH 7.5) to obtain the protoplast suspension after resuspension, centrifuge the suspension at 5000rpm for 10min. At this time, the protoplast floats on the top of the liquid surface of the centrifuge tube, and the impurities settle to the bottom of the tube. Protoplasts in a new 1.5mL centrifuge tube, diluted to 10 8 pcs mL -1 spare.

Embodiment 3

[0042] Embodiment 3: Construction of MAPKK gene knockout plasmid

[0043] Using the pCT74 plasmid as the backbone, the CDS region of the Cas9 protein was amplified from the pX330 plasmid by PCR, and the amplified DNA fragment was seamlessly cloned into the front of the fluorescent protein in the pCT74 plasmid, so that the Cas9 protein and the fluorescent protein were seamlessly fused into one protein , the first plasmid pCT74-Cas9 was constructed; the U6 promoter of Aspergillus fumigatus was amplified by PCR using the Aspergillus fumigatus genome as a template, and the U6 promoter and the sgRNA backbone of MAPKK were fused into a DNA fragment and cloned seamlessly into the first The XhoI restriction site of plasmid pCT74-Cas9 was used to construct the second plasmid pCT74-Cas9-sgRNA; using the website http: / / zifit.partners.org / ZiFiT / CSquare9Nuclease.aspx Design the gRNA sequence of the target gene (sequence: GGGGCGTTCATCATGGGGAC, SEQ ID No.1), select two complementary gRNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a naringenin production method based on phomopsis cell fermentation. After an MAPKK gene related to the endogenous fungus phomopsis global regulation factor signal transduction is knocked out by CRISPR-Cas9, biosynthesis of naringenin is activated, and naringenin can be obtained from fermentation broth and mycelia of mutant strains. Naringenin is produced in a microbial natural synthesis way for the first time, the rapid naringenin production method is provided, defects of long period and difficulty in extraction of a plant extraction method and defects of poor product selectivity, low product purity, harsh reaction conditions and serious environmental pollution of a chemical synthesis method are overcome, the method has the advantages of good selectivity, high product purity and mild reaction conditions, is simple and convenient to operate and has good application prospect in food and medicine production, and a new idea is provided for naringenin production.

Description

Technical field: [0001] The application relates to the fields of molecular biology and biotechnology, in particular to a method for producing naringenin based on Phomopsis cell fermentation. Background technique: [0002] Flavonoids play an important role in plant growth, development, flowering, fruiting, antibacterial and disease prevention. Naringenin (4',5,7-trihydroxyflavone) is an important dihydroflavonoid compound, which can be modified by specific groups, such as hydroxylation, acetylation, glycosylation, etc. to generate a series of Downstream flavonoid products. Naringenin and its derivatives are commonly found in higher plants, such as tomatoes and citrus fruits. Pharmacological studies have shown that naringenin and its derivatives have various activities such as anti-inflammation, anti-oxidation, anti-virus, and prevention of atherosclerosis [Iwashina T. Biol Sci Space, 2003, 17(1): 24-44]. In recent years, the role of naringenin in the prevention and treatme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P17/06C12N15/80C12N15/90C12N15/54C12R1/645
CPCC12P17/06C12N15/80C12N15/902C12N9/12C12Y207/12002C12N2810/10
Inventor梅艳珍戴传超杨倩黄鹏伟
OwnerNANJING NORMAL UNIVERSITY