Application of lactobacillus paracasei L9 to prevention or treatment oral disease and regulation of oral cavity flora
A technology for oral diseases and side cheese, applied in the direction of Lactobacillus, oral care, application, etc., to achieve the effect of reducing thickness and density, and reducing the amount of adhesion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1——in vitro inhibition of adhesion of Lactobacillus paracasei L9 to oral pathogenic bacteria
[0046] Specific primers capable of amplifying Streptococcus mutans and Streptococcus gordii, but not Lactobacillus paracasei, were screened by quantitative PCR—forward primer (5′-3′) sequence: GCCTACAGCTCAGAGATGCTATTCT, reverse primer (5'-3') sequence: GCCATACACCACTCATGAATTGA. The primer reaction system and reaction conditions are: 2.5 μl DNA, 10 μl Taq enzyme, 0.5 μl upstream primer, 0.5 μl downstream primer, 6.5 μl ultrapure water; pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 5 seconds, annealing at an annealing temperature of 60°C 60s, 72°C extension for 30s, 40 cycles; 72°C extension for 5min.
[0047] Use the above-mentioned specific primers to carry out quantitative PCR amplification of pathogenic bacteria, perform agarose gel electrophoresis on the product, cut the gel and recover the DNA using a gel recovery kit, measure the standard DNA c...
Embodiment 2
[0062] Embodiment 2——Influence of Lactobacillus paracasei L9 on the diversity of mouse oral flora
[0063] Streptococcus mutans 1.2499 and Lactobacillus paracasei L9 stored at -20°C were respectively activated and cultured in 10ml of BHI, MRS and M17 broth medium for three generations at 37°C, centrifuged at 4500r / min for 10min, and the supernatant was removed. Streptococcus mutans Redissolve the bacteria slime with sterile normal saline, redissolve Lactobacillus paracasei L9 with sucrose solution, and adjust the concentration of the bacteria solution to 10 8 cfu / ml, stored at 4°C for later use.
[0064] Mice dental caries modeling method:
[0065] The animal model of this embodiment has selected 28 male SPF level BALB / c mice of 3 weeks old purchased from Weitong Lihua, 7 in each group, divided into control group, model group, Lactobacillus paracasei L9 group There are 3 groups in total. The purchased SPF mice were randomly divided into four groups after a one-week adaptati...
Embodiment 3
[0096] Embodiment 3——Influence of Lactobacillus paracasei L9 on the diversity of human oral flora
[0097] To recruit staff:
[0098] (1) Inclusion criteria
[0099] ① Subjects without active caries
[0100] ②Without any systemic diseases
[0101] ③ Subjects without any history of preventive dental treatment
[0102] (2) Exclusion criteria
[0103] ①Those who received antibiotic treatment during the study
[0104] ② People who used any other probiotic supplements (yogurt or other supplements containing probiotics) during the study
[0105] ③ Subjects who used xylitol products 1 week before the start of the experiment and during the study
[0106] ④ Subjects with a history of intraoral surgery within 6 months before the start of the experiment
[0107] ⑤ Current smokers or smokers one year before the start of the experiment
[0108] (3) Requirements for subjects during the experiment
[0109] Subjects were required to take a probiotic tablet in the morning (before 9:00...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com