Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of lactobacillus paracasei L9 to prevention or treatment oral disease and regulation of oral cavity flora

A technology for oral diseases and side cheese, applied in the direction of Lactobacillus, oral care, application, etc., to achieve the effect of reducing thickness and density, and reducing the amount of adhesion

Inactive Publication Date: 2019-10-18
BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The strain Lactobacillus paracasei L9 used in this study is a probiotic strain isolated from the feces of long-lived elderly people. Experiments have proved that this strain has high safety, but it has not been used in oral research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of lactobacillus paracasei L9 to prevention or treatment oral disease and regulation of oral cavity flora
  • Application of lactobacillus paracasei L9 to prevention or treatment oral disease and regulation of oral cavity flora
  • Application of lactobacillus paracasei L9 to prevention or treatment oral disease and regulation of oral cavity flora

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1——in vitro inhibition of adhesion of Lactobacillus paracasei L9 to oral pathogenic bacteria

[0046] Specific primers capable of amplifying Streptococcus mutans and Streptococcus gordii, but not Lactobacillus paracasei, were screened by quantitative PCR—forward primer (5′-3′) sequence: GCCTACAGCTCAGAGATGCTATTCT, reverse primer (5'-3') sequence: GCCATACACCACTCATGAATTGA. The primer reaction system and reaction conditions are: 2.5 μl DNA, 10 μl Taq enzyme, 0.5 μl upstream primer, 0.5 μl downstream primer, 6.5 μl ultrapure water; pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 5 seconds, annealing at an annealing temperature of 60°C 60s, 72°C extension for 30s, 40 cycles; 72°C extension for 5min.

[0047] Use the above-mentioned specific primers to carry out quantitative PCR amplification of pathogenic bacteria, perform agarose gel electrophoresis on the product, cut the gel and recover the DNA using a gel recovery kit, measure the standard DNA c...

Embodiment 2

[0062] Embodiment 2——Influence of Lactobacillus paracasei L9 on the diversity of mouse oral flora

[0063] Streptococcus mutans 1.2499 and Lactobacillus paracasei L9 stored at -20°C were respectively activated and cultured in 10ml of BHI, MRS and M17 broth medium for three generations at 37°C, centrifuged at 4500r / min for 10min, and the supernatant was removed. Streptococcus mutans Redissolve the bacteria slime with sterile normal saline, redissolve Lactobacillus paracasei L9 with sucrose solution, and adjust the concentration of the bacteria solution to 10 8 cfu / ml, stored at 4°C for later use.

[0064] Mice dental caries modeling method:

[0065] The animal model of this embodiment has selected 28 male SPF level BALB / c mice of 3 weeks old purchased from Weitong Lihua, 7 in each group, divided into control group, model group, Lactobacillus paracasei L9 group There are 3 groups in total. The purchased SPF mice were randomly divided into four groups after a one-week adaptati...

Embodiment 3

[0096] Embodiment 3——Influence of Lactobacillus paracasei L9 on the diversity of human oral flora

[0097] To recruit staff:

[0098] (1) Inclusion criteria

[0099] ① Subjects without active caries

[0100] ②Without any systemic diseases

[0101] ③ Subjects without any history of preventive dental treatment

[0102] (2) Exclusion criteria

[0103] ①Those who received antibiotic treatment during the study

[0104] ② People who used any other probiotic supplements (yogurt or other supplements containing probiotics) during the study

[0105] ③ Subjects who used xylitol products 1 week before the start of the experiment and during the study

[0106] ④ Subjects with a history of intraoral surgery within 6 months before the start of the experiment

[0107] ⑤ Current smokers or smokers one year before the start of the experiment

[0108] (3) Requirements for subjects during the experiment

[0109] Subjects were required to take a probiotic tablet in the morning (before 9:00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of lactobacillus paracasei L9 to prevention or treatment oral disease and regulation of oral cavity flora. L9 can be used for preparing a medical composition anda food for preventing or treating dental caries. Research proves that L9 can notably relieve generation degree of occlusal surface E-level dental caries, after the LP is taken, the structure of the oral cavity flora is changed notably, particularly actinobacteria is notably increased, the actinobacteria of L9 group is obviously reduced, klebsiella, aerococcus, Gemella, corynebacterium and pseudomonas aeruginosa on the classification level are notably reduced, and the oral disease risk is reduced. When L9 is taken, the saliva species richness is notably reduced, the relative abundance of oraldisease relevant fungi of streptococcus salivarius, actinomycetaceae, peptostreptococcus and the like is notably reduced, and the L9 can have relieving effects on periodonitis diseases. The dental plaque flora species diversity is notably reduced, the relative abundance of leptothrix, fusobacteriaceaeand flavobacterium is notably reduced, and the L9 can have relieving effects on oral diseases of periodontal disease, halitosis, dental caries and the like.

Description

technical field [0001] The invention belongs to the field of prevention and treatment of oral diseases, and in particular relates to the use of Lactobacillus paracasei L9 for preventing or treating oral diseases and regulating oral flora. Background technique [0002] With the improvement of the quality of life of Chinese residents, oral health has become a public health issue of great concern. For a long time, the incidence of some common oral diseases, such as dental caries, periodontal disease and mucosal disease, has been increasing year by year. Oral diseases not only affect people's oral health, but also cause some systemic diseases, and oral pathogenic bacteria are the key factors causing these diseases. Other systemic diseases are of crucial importance. [0003] A large number of clinical studies have proved that probiotics play a pivotal role in preventing or reducing oral diseases. Among them, Lactobacillus rhamnosus LGG can not only inhibit the growth of oral p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K35/747A61P1/02A61K8/99A61Q11/00A23C9/12A23F3/14A23F5/10A23G3/36A23L33/135
CPCA61K35/747A61P1/02A61K8/99A61Q11/00A23C9/1203A23F3/14A23F5/10A23G3/366A23L33/135A23V2002/00A23V2200/30A23V2400/165
Inventor 张明韩雨婷董园园赵亮
Owner BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More