Application of wx mutant protein and its gene in plant breeding based on gene editing technology
A mutant, protein technology, applied in applications, plant products, genetic engineering, etc., can solve the problems of difficulty in meeting the urgent needs of high-quality soft fragrant rice varieties, multiple genetic mutations in wild-type materials, and poor appearance and quality of rice, and achieve improvement. Effects of palatability and eating quality, improved breeding efficiency, and appropriate BDV elevation values
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] Example 1: Obtainment of Genetically Transformed Plants
[0079] 1. Suken 118Wx gene cloning and target site design
[0080] With reference to the CTAB method of Murray et al., the genomic DNA of Suken 118 was extracted (Murray MG, et al., Nucleic Acids Research, 1980, 8(19): 4321-4326). The genomic DNA was amplified by PCR with primers Wx-F: CCCTAGCCACCCAAGAAA (SEQ ID NO: 5), Wx-R: CACCCAGAAGAGTACAACATCA (SEQ ID NO: 6), and the amplified product was sent to Yingweijieji (Shanghai) Trading Co., Ltd. The company conducts sequencing. The sequencing results were compared in the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) database for Blast analysis, and it was found that the sequence of the Wx gene coding region of Suken 118 was the same as that of the reference genome rice Nipponbare.
[0081] According to the Wx gene sequence of Suken 118, the CRISPR-GE website (http: / / skl.scau.edu.cn / targetdesign / ) predicted that the target site wxb#9 was designed on exon 4: CGACT...
Embodiment 2
[0114] Example 2: Knockout of mutant exogenous DNA (T-DNA), re-identification of genotype and screening of homozygous plants
[0115] The pH-nCas9-PBE-wxb#9 and pH-nCas9-PBE-wxb#24 vectors constructed by the present invention for directional and precise single-base editing of the Wx gene are both binary T-DNA vectors, and the T-DNA involved in the present invention is mainly It contains the hygromycin phosphotransferase HPT gene and the nCas9 nuclease gene. For the rice genome, these two genes, as the representative exogenous DNA, need to be deleted for the following reasons: 1) The hygromycin phosphotransferase HPT gene is mainly The function is to serve as a selection marker in the process of genetic transformation, and the corresponding encoded hygromycin protein is a class of antibiotics; 2) The main function of the nCas9 gene is to complete the site-directed cleavage of the target site of the target gene, and its continued retention in the plant may cause Secondary editin...
Embodiment 3
[0121] Example 3 Phenotypic analysis of mutants
[0122] Eating and Cooking Quality (ECQ) is a direct factor affecting consumers' choice, so it is the most important evaluation index in the composition of rice quality. Although my country has promulgated the national standard "Rice Cooking and Edible Quality Sensory Evaluation Method" (GB / T15682-2008), due to the inability to completely exclude the influence of subjective factors, the method of manual tasting still cannot accurately identify the quality of rice. Since starch is the main component of rice endosperm, the composition and structure of starch are the most important factors affecting rice ECQ. This example utilizes the 4 Ts obtained in Example 2 2 Generation of seeds of T-DNA knockout homozygous mutants 118-1-1, 118-3-2, 118-5-1 and 118-9-15 (T 3 Substitute) for the determination of some physical and chemical indicators of starch, so as to objectively evaluate the rice ECQ.
[0123] 1. Determination of amylose co...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



