Check patentability & draft patents in minutes with Patsnap Eureka AI!

Indirect ELISA kit for detecting canine parainfluenza virus antibody

A technology of canine parainfluenza virus and kit, which is applied in the field of animal virology and immunology, can solve the problems of easy mutation of genes and achieve high specificity, excellent detection effect, rapid and sensitive detection

Inactive Publication Date: 2016-12-21
HUAZHONG AGRI UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the CPIV HN protein is a viral membrane protein, and the gene is prone to mutation, and the antigenic epitope will also change accordingly. It is not as conservative and stable as the CPIV NP protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indirect ELISA kit for detecting canine parainfluenza virus antibody
  • Indirect ELISA kit for detecting canine parainfluenza virus antibody
  • Indirect ELISA kit for detecting canine parainfluenza virus antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Expression and purification of canine parainfluenza virus NP protein

[0036] 1. Cloning of CPIV NP gene

[0037] According to the gene sequence of NP protein published on NCBI (NCBI Reference Sequence: NC_006430.1 Parainfluenza virus 5, complete genome), a pair of specific primers (NP-F: CCGGAATTCATGTCATCCGTGCTTA, NP-R: ATAGTTTAGCGGCCGCTTAGATGTCAAGATCACCCA), using the pET-28a-NP plasmid stored in the laboratory as a template to clone the full length of the CPIV NP gene (primer star, 50 μL), the reaction system and procedures are as follows:

[0038]

[0039] After the reaction system was added, it was briefly centrifuged, and PCR amplification was carried out according to the following procedure:

[0040]

[0041] The PCR products were separated and recovered with 1% agarose gel (for the specific operation steps of gel recovery, refer to the kit manual; BioSpin Gel Extraction Kit, Bioer Technology Co., Ltd.). The concentration and quality of the recov...

Embodiment 2

[0054] Example 2 Establishment of an indirect ELISA detection method for canine parainfluenza virus antibody

[0055] 1. Determination of the optimal reaction conditions of the canine parainfluenza virus antibody indirect ELISA detection kit

[0056] The NP protein-coated microtiter plate prepared by the present invention is used as an antigen, and the HRP-labeled goat anti-canine secondary antibody binds to the canine serum primary antibody, and catalyzes the color development of the TMB substrate. The optimal coating concentration of the protein was determined by square array titration to be 0.95 μg / mL, and the optimal dilution factor of the enzyme-labeled antibody was 1:5000.

[0057] 2. Determination of the negative and positive critical values ​​of the canine parainfluenza virus antibody indirect ELISA detection kit

[0058] Detect 37 canine serum samples that were negative for canine parainfluenza virus antibody by indirect immunofluorescence (IFA), and set up standard ...

Embodiment 3

[0084] Example 3 Assembly of canine parainfluenza virus antibody indirect ELISA antibody detection kit

[0085] 1. ELISA kit assembly

[0086] (1) 96-well ELISA plate coated with canine parainfluenza NP protein;

[0087] (2) Standard positive control: canine parainfluenza positive serum;

[0088] (3) Standard negative control: canine parainfluenza negative serum;

[0089] (4) horseradish peroxidase-labeled sheep anti-dog enzyme-labeled antibody;

[0090] (5) Washing solution (10×concentration): NaCl 80.0g, KH 2 PO 4 2.7g, Na 2 HPO 4 14.2g, KCl 2.0g, Tween20 5ml, add double distilled water to 1000ml;

[0091] (6) Chromogenic substrate solution A: Dissolve TMB in DMSO to a final concentration of 11 mg / mL, add 1 / 10 volume of glycerol, and then add L-cysteine ​​at a final concentration of 0.5 mg / mL Hydrochloride;

[0092] (7) Chromogenic substrate solution B: 0.15wt% citric acid, 0.25wt% disodium hydrogen phosphate, 0.01wt% sodium sulfite, 0.002wt% EDTA, 0.001wt% Tween2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of canine parainfluenza virus nucleocapsid protein in preparing an indirect ELISA kit for detecting canine parainfluenza virus antibody, and the invention also discloses an indirect ELISA kit for detecting canine parainfluenza virus antibody. The kit can be used for rapid detection of canine parainfluenza virus antibody in clinical canine serum samples and antibody monitoring of immunized dogs, and has the characteristics of high detection specificity, sensitivity and reproducibility.

Description

technical field [0001] The invention belongs to the technical field of animal virology and immunology, and specifically relates to the application of canine parainfluenza virus nucleocapsid protein in the preparation of an indirect ELISA kit for detecting canine parainfluenza virus antibodies, and the invention also relates to a method for detecting canine parainfluenza virus Indirect ELISA kit for antibodies. Background technique [0002] Canine parainfluenza is an infectious disease of dogs caused by canine parainfluenza virus (CPIV, hereinafter referred to as CPIV). The disease is widespread. The virus invades the dog's respiratory system, causing inflammation of the respiratory system. The clinical manifestations are fever, coughing, and runny nose. It is often mixed with bacteria, mycoplasma and other viruses, which makes the dog's condition worse. Canine parainfluenza is currently one of the main infectious diseases in the dog industry, especially in pet dogs. [000...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569
CPCG01N33/56983G01N2333/11G01N2469/20
Inventor 崔旻柴本杰彭贵青傅振芳杨宏
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More