Method for biosynthesis of quercetin glycoside
A quercetin glycoside and biosynthetic technology, applied in the field of genetic engineering, to achieve the effects of improving organic solvent tolerance and enzyme activity, increasing conversion rate, product quantity, and large yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0028] Example 1 Preparation of glycosyltransferase mutant
[0029] (1) Single mutation
[0030] Two mutants V371A of the glycosyltransferase UGT73G1 derived from onion, the amino acid sequence of SEQ ID NO. 2, F381Y, and the amino acid sequence of SEQ ID NO. 3 are shown;
[0031] According to the gene sequence of glycosyltransferase UGT73G1, conduct site-directed mutagenesis, determine the DNA coding sequence, and introduce it into E. coli for expression to obtain single mutant glycosyltransferase, single mutant V371A, F381Y are synthesized by GenScript Biotechnology Co., Ltd. Constructed on pet28a vector.
[0032] The site-directed mutagenesis primers of V371A are:
[0033] Forward primer:
[0034] TAAGAAGGAGATATACATATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTG
[0035] Reverse primer:
[0036] GGTTTCTTTACCAGACTCGAGTCATTA GTGGTGGTGGTGGTGGTG TTTGTTGCGACGGTC
[0037] The site-directed mutagenesis primers of F381Y are:
[0038] Forward primer:
[0039] TAAGAAGGAGATATACATATGGGCAGCAGC CATCATCATCA...
Embodiment 2
[0055] Example 2 Fermentation induction of mutant enzyme
[0056] Inoculate BL21 (DE) Escherichia coli with recombinant plasmid pRSF-UGT-SUS in 100mL LB liquid medium (containing 50μg / mL kanamycin), culture at 37℃, 200r / min until OD600 reaches 2-3, add The inducer lactose was induced to a final concentration of 1g / L at 25°C and 200r / min for 20h. The fermentation broth was centrifuged at 4℃, 6000 / min for 3min, and 8mL of 100mM potassium phosphate buffer (pH8.0) was used to resuspend the bacteria. The mutant enzyme was extracted with an ultrasonic disintegrator. Disruption conditions: 300W, working time 1s, intermittent 2s, whole process 15min. The crushing liquid was separated at 4℃, 8000r / min for 25min, and the supernatant was collected. Heart for 10min, collect the supernatant.
Embodiment 3
[0057] Example 3 Determination method of conversion rate of glycosyltransferase mutant and sucrose synthase coupling double enzyme
[0058] Glycosyltransferase enzyme activity determination method: in a 220 μl reaction system (0.5 mM quercetin, 5 mM UDPG, 5 mMMgCl 2 , Ph-7.2 potassium phosphate buffer), add the crude enzyme solution with a final protein concentration of 3 mg / ml to react. After reacting at 37°C for 30 min, take 220 μl of the reaction solution, add 180 μl of methanol to terminate the reaction, and centrifuge at 12000 rpm for 1 min The supernatant was analyzed by high performance liquid chromatography (HPLC). Enzyme activity unit is defined as: Under the above reaction conditions, the amount of enzyme required to catalyze the formation of 1 μmol isoquercitrin in 1 min is 1 activity unit (U).
[0059] The enzyme activity determination method of sucrose synthase: In a 3ml reaction system (500mM sucrose, 10mM UDP, ph=7.2 potassium phosphate buffer), add 6mg protein. Rea...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More