Method for biosynthesis of quercetin glycoside

A quercetin glycoside and biosynthetic technology, applied in the field of genetic engineering, to achieve the effects of improving organic solvent tolerance and enzyme activity, increasing conversion rate, product quantity, and large yield

Active Publication Date: 2019-01-18
NANJING UNIV OF TECH
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The microbial transformation method is one-step transformation, the process is simple, and it is easy to control. At present, there are few domestic reports on the preparation of quercetin-3,4'-diglucoside

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Preparation of glycosyltransferase mutant

[0029] (1) Single mutation

[0030] Two mutants V371A of the glycosyltransferase UGT73G1 derived from onion, the amino acid sequence of SEQ ID NO. 2, F381Y, and the amino acid sequence of SEQ ID NO. 3 are shown;

[0031] According to the gene sequence of glycosyltransferase UGT73G1, conduct site-directed mutagenesis, determine the DNA coding sequence, and introduce it into E. coli for expression to obtain single mutant glycosyltransferase, single mutant V371A, F381Y are synthesized by GenScript Biotechnology Co., Ltd. Constructed on pet28a vector.

[0032] The site-directed mutagenesis primers of V371A are:

[0033] Forward primer:

[0034] TAAGAAGGAGATATACATATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTG

[0035] Reverse primer:

[0036] GGTTTCTTTACCAGACTCGAGTCATTA GTGGTGGTGGTGGTGGTG TTTGTTGCGACGGTC

[0037] The site-directed mutagenesis primers of F381Y are:

[0038] Forward primer:

[0039] TAAGAAGGAGATATACATATGGGCAGCAGC CATCATCATCA...

Embodiment 2

[0055] Example 2 Fermentation induction of mutant enzyme

[0056] Inoculate BL21 (DE) Escherichia coli with recombinant plasmid pRSF-UGT-SUS in 100mL LB liquid medium (containing 50μg / mL kanamycin), culture at 37℃, 200r / min until OD600 reaches 2-3, add The inducer lactose was induced to a final concentration of 1g / L at 25°C and 200r / min for 20h. The fermentation broth was centrifuged at 4℃, 6000 / min for 3min, and 8mL of 100mM potassium phosphate buffer (pH8.0) was used to resuspend the bacteria. The mutant enzyme was extracted with an ultrasonic disintegrator. Disruption conditions: 300W, working time 1s, intermittent 2s, whole process 15min. The crushing liquid was separated at 4℃, 8000r / min for 25min, and the supernatant was collected. Heart for 10min, collect the supernatant.

Embodiment 3

[0057] Example 3 Determination method of conversion rate of glycosyltransferase mutant and sucrose synthase coupling double enzyme

[0058] Glycosyltransferase enzyme activity determination method: in a 220 μl reaction system (0.5 mM quercetin, 5 mM UDPG, 5 mMMgCl 2 , Ph-7.2 potassium phosphate buffer), add the crude enzyme solution with a final protein concentration of 3 mg / ml to react. After reacting at 37°C for 30 min, take 220 μl of the reaction solution, add 180 μl of methanol to terminate the reaction, and centrifuge at 12000 rpm for 1 min The supernatant was analyzed by high performance liquid chromatography (HPLC). Enzyme activity unit is defined as: Under the above reaction conditions, the amount of enzyme required to catalyze the formation of 1 μmol isoquercitrin in 1 min is 1 activity unit (U).

[0059] The enzyme activity determination method of sucrose synthase: In a 3ml reaction system (500mM sucrose, 10mM UDP, ph=7.2 potassium phosphate buffer), add 6mg protein. Rea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for biosynthesis of quercetin glycoside, which connects the gene of glycosyltransferase UGT73G1 or mutant thereof with sucrose synthase gene to obtain a recombinant plasmid, and constructs a recombinant bacterium containing a double enzyme system; The recombinant strain was inoculated in LB liquid medium, cultured at 25-40 DEG C until OD600 reached 2-3, adding inducer lactose to induce for 12 to 20 hour, centrifuging that fermentation broth to collect bacterial cells, crushing the bacterial cell, and centrifuging to collect supernatant to obtain crude enzyme solution; dissolving quercetin or isoquercetin in DMSO, add crude enzyme solution, sucrose, reaction 8-30 h, adding methanol to stop that reaction, and centrifuging to obtain the supernatant quercetin-3, 4'-Diglucoside; diglucoside. The amino acid sequence of the glycosyltransferase mutant is an amino acid sequence in which the amino acid sequence shown in SEQID NO: 1 is mutated, and the mutated amino acid site is selected from one or more of S151, T168, K274, T293, G361, S365, V371 and F381. The mutant is simple in preparation and high in yield, and realizes the function of quercetin The yieldof 3, 4 '-diglucoside was increased.

Description

Technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a biosynthesis method of quercetin glycoside. Background technique [0002] Quercetin, also known as quercetin and quercetin yellow, as a natural flavonoid compound, is widely present in the flowers, leaves and fruits of plants, mostly in the form of glycosides, and has good expectorant properties , Antitussive effect. In addition, it has the effects of lowering blood pressure, enhancing capillary resistance, reducing capillary fragility, lowering blood lipids, dilating coronary arteries, and increasing coronary blood flow. In the United States, quercetin is an over-the-counter treatment for prostate cancer, but in China, it has not been approved as a prostate treatment. Quercetin is insoluble in water. The introduction of hydrophilic groups can increase its solubility and facilitate absorption, thereby enhancing its pharmacological effects. Glycosylation of q...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/18C12P19/60
CPCC12P19/18C12P19/60
Inventor贾红华李艳蔡如鑫严明陈可泉
OwnerNANJING UNIV OF TECH